Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU019031

Sigma-Aldrich

MISSION® esiRNA

targeting human CST3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAGCGGGTCCTCTCTATCTAGCTCCAGCCTCTCGCCTGCGCCCCACTCCCCGCGTCCCGCGTCCTAGCCGACCATGGCCGGGCCCCTGCGCGCCCCGCTGCTCCTGCTGGCCATCCTGGCCGTGGCCCTGGCCGTGAGCCCCGCGGCCGGCTCCAGTCCCGGCAAGCCGCCGCGCCTAGTGGGAGGCCCCATGGACGCCAGCGTGGAGGAGGAGGGTGTGCGGCGTGCACTGGACTTTGCCGTCGGCGAGTACAACAAAGCCAGCAACGACATGTACCACAGCCGCGCGCTGCAGGTGGTGCGCGCCCGCAAGCAGATCGTAGCTGGGGTGAACTACTTCTTGGACGTGGAGCTGGGCCGAACCACGTGTACCAAGACCCAGCCCAACTTGGACAACTGCCCCTTCCATGACCAGCCACATCTGAAAAGGAAAGCATTCTGCTCTTTCCAGATCTACGCTGTGCCTTGGCAGGGCACAATGACCTTGTCGAAATCCACCTGT

Ensembl | nº de acceso humano

ENSG00000101439

Nº de acceso NCBI

NM_000099

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CST3(1471) , CST3(1471)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bo Yang et al.
Journal of neurochemistry, 153(3), 413-425 (2019-10-12)
Cystatin C, a well-established biomarker of renal function, has been associated with a protective effect against stroke. However, the potential neuroprotective mechanism of cystatin C in ischemic brain injury remains unclear. Our study hypothesized that cystatin C can ameliorate blood-brain
Hyun Jung Chung et al.
PloS one, 10(7), e0133417-e0133417 (2015-07-18)
The high incidence of acute and chronic kidney injury due to various environmental factors such as heavy metals or chemicals has been a major problem in developing countries. However, the diagnosis of kidney injury in these areas can be more

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico