Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU018981

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB11A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGCAACAAGAAGCATCCAGGTTGATGGAAAAACAATAAAGGCACAGATATGGGACACAGCAGGGCAAGAGCGATATCGAGCTATAACATCAGCATATTATCGTGGAGCTGTAGGTGCCTTATTGGTTTATGACATTGCTAAACATCTCACATATGAAAATGTAGAGCGATGGCTGAAAGAACTGAGAGATCATGCTGATAGTAACATTGTTATCATGCTTGTGGGCAATAAGAGTGATCTACGTCATCTCAGGGCAGTTCCTACAGATGAAGCAAGAGCTTTTGCAGAAAAGAATGGTTTGTCATTCATTGAAACTTCGGCCCTAGACTCTACAAATGTAGAAGCTGCTTTTCAGACAATTTTAACAGAGATTTACCGCATTGTTTCTCAGAAGCAAATGTCAGACAGACGCGAAAATGACATG

Ensembl | nº de acceso humano

ENSG00000103769

Nº de acceso NCBI

NM_004663

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RAB11A(8766) , RAB11A(8766)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Danyi Zhao et al.
Acta biochimica Polonica, 67(4), 531-538 (2020-12-17)
Esophageal cancer (EC) recently has become a common malignancy of digestive system worldwide. RAB11A is a critical member of the small GTPases superfamily and was reported to affect a variety of cellular functions. However, its potential effects on EC progression
Yunxia Zhang et al.
Cancer cell international, 20(1), 571-571 (2020-12-10)
Prostate cancer (PC) is common male cancer with high mortality worldwide. Emerging evidence demonstrated that long noncoding RNAs (lncRNAs) play critical roles in various type of cancers including PC by serving as competing endogenous RNAs (ceRNAs) to modulate microRNAs (miRNAs).
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted
Liane Rauch et al.
Traffic (Copenhagen, Denmark), 15(10), 1083-1098 (2014-07-22)
Bacteria that invade human endothelial cells can be efficiently eliminated in phagolysosomes. We investigated the role of vesicle tethering exocyst complex in maturation and function of endothelial cell phagosomes harbouring staphylococci or latex beads. Exocyst complex proteins (Sec5, -8, -10
Ola Sabet et al.
Nature communications, 6, 8047-8047 (2015-08-22)
Autocatalytic phosphorylation of receptor tyrosine kinases (RTKs) enables diverse, context-dependent responses to extracellular signals but comes at the price of autonomous, ligand-independent activation. Using a conformational biosensor that reports on the kinase activity of the cell guidance ephrin receptor type-A

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico