Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU018281

Sigma-Aldrich

MISSION® esiRNA

targeting human TXNRD1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAAGCCCTGCAAGACTCTCGAAATTATGGATGGAAAGTCGAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAATCACATTGGCTCTTTGAATTGGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCTTATGGGCAATTTATTGGTCCTCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCAGCAGAGAGATTTCTCATTGCCACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATACTGCATCAGCAGTGATGATCTTTTCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCCTATGTCGCTTTGGAGTGCGCTGGATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCCATTCTTCTTAGAGGATTTGACCAGGACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCA

Ensembl | nº de acceso humano

ENSG00000198431

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TXNRD1(7296) , TXNRD1(7296)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bin Zhu et al.
Biochemical pharmacology, 170, 113642-113642 (2019-09-22)
Lung cancer, similar to other chronic diseases, occurs due to perturbations in multiple signaling pathways. Mono-targeted therapies are not ideal since they are not likely to be effective for the treatment and prevention of lung cancer, and are often associated
Yichong Wang et al.
Oncology reports, 37(5), 2905-2912 (2017-04-14)
Aberrant neovascularization supports nutrients and the oxygen microenvironment in tumour growth, invasion and metastasis. Recapitulation of functional microvascular structures in vitro could provide a platform for the study of vascular conditions. Sulforaphane (SFN), an isothiocyanate, has been reported to possess chemopreventive
Chuncheng Hao et al.
Oncology letters, 13(4), 2071-2078 (2017-04-30)
Radiation treatment remains one of the major modalities in the treatment of lung cancer. Although the majority of patients initially respond to treatment with radiation, resistance inevitably develops and leads to treatment failure. Therefore, the identification of the underlying molecular
Xinzhi Wang et al.
Redox biology, 24, 101153-101153 (2019-03-26)
The early immature CD34+ acute myeloid leukemia (AML) cell subpopulation-acute myeloid leukemia progenitor cells (APCs), is often resistant to conventional chemotherapy, making them largely responsible for the relapse of AML. However, to date, the eradication of APCs remains a major
Bo Ra You et al.
Molecular carcinogenesis, 53(11), 847-857 (2013-05-11)
Zebularine (Zeb) is a DNA methyltransferase (DNMT) inhibitor to that has an anti-tumor effect. Here, we evaluated the anti-growth effect of Zeb on A549 lung cancer cells in relation to reactive oxygen species (ROS) levels. Zeb inhibited the growth of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico