Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU016411

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPKAPK5 (2)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTGGGAGCTGGAATTAGTGGTCCAGTTAGAGTCTGTGTAAAGAAATCTACTCAAGAACGGTTTGCGCTGAAAATTCTTCTTGATCGTCCAAAAGCTAGAAATGAGGTACGTCTGCACATGATGTGTGCCACACACCCAAACATAGTTCAGATTATTGAAGTGTTTGCTAACAGTGTCCAGTTTCCCCATGAGTCCAGCCCTAGGGCCCGACTCTTAATTGTAATGGAGATGATGGAAGGGGGAGAGCTATTTCACAGAATCAGCCAGCACCGGCACTTTACAGAGAAGCAAGCCAGCCAAGTAACAAAGCAGGCAACTTTGGCTCTGCGGCACTGTCACTTGTTAAACATTGCGCACAGAGACCTCAAGCCTGAAAATCTGCTTTTTAAGGATAACTCTTTGGATGCCCCAGTGAAGTTGTGTGACTTTGGATTTGCCAAGATTGACCAAGGTGACTTGATGACACCCCAGTTCACCCCTTATTATGTAGCACCCCAGGTACTGGA

Ensembl | nº de acceso humano

ENSG00000089022

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MAPKAPK5(8550) , MAPKAPK5(8550)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sherin Ali Nawaito et al.
American journal of physiology. Heart and circulatory physiology, 316(6), H1281-H1296 (2019-03-23)
MK5 is a protein serine/threonine kinase activated by p38, ERK3, and ERK4 MAPKs. MK5 mRNA and immunoreactivity are detected in mouse cardiac fibroblasts, and MK5 haplodeficiency attenuates the increase in collagen 1-α1 mRNA evoked by pressure overload. The present study
Natalia Ronkina et al.
PloS one, 10(8), e0136138-e0136138 (2015-08-22)
MK5 (MAPK-activated protein kinase 5) or PRAK (p38-regulated and -activated kinase) are alternative names for a serine/threonine protein kinase downstream to ERK3/4 and p38 MAPK. A previous gene targeting approach for MK5/PRAK (termed here MK5/PRAK-Δex8) revealed a seemingly tumor-suppressive role
Yoonhee Kim et al.
Molecular neurodegeneration, 11, 4-4 (2016-01-14)
The receptor for advanced glycation end products (RAGE) has been found to interact with amyloid β (Aβ). Although RAGE does not have any kinase motifs in its cytosolic domain, the interaction between RAGE and Aβ triggers multiple cellular signaling involved
Katarzyna Bogucka et al.
eLife, 9 (2020-04-22)
ERK3 is a ubiquitously expressed member of the atypical mitogen activated protein kinases (MAPKs) and the physiological significance of its short half-life remains unclear. By employing gastrointestinal 3D organoids, we detect that ERK3 protein levels steadily decrease during epithelial differentiation.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico