Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU016271

Sigma-Aldrich

MISSION® esiRNA

targeting human JAM3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAATGACCGCAAGGAAATTGATGAGATTGTGATCGAGTTAACTGTGCAAGTGAAGCCAGTGACCCCTGTCTGTAGAGTGCCGAAGGCTGTACCAGTAGGCAAGATGGCAACACTGCACTGCCAGGAGAGTGAGGGCCACCCCCGGCCTCACTACAGCTGGTATCGCAATGATGTACCACTGCCCACGGATTCCAGAGCCAATCCCAGATTTCGCAATTCTTCTTTCCACTTAAACTCTGAAACAGGCACTTTGGTGTTCACTGCTGTTCACAAGGACGACTCTGGGCAGTACTACTGCATTGCTTCCAATGACGCAGGCTCAGCCAGGTGTGAGGAGCAGGAGATGGAAGTCTATGACCTGAACATTGGCGGAATTATTGGGGGGGTTCTGGTTGTCCTTGCTGTACTGGCCCTGATCACGTTGGGCATCTGCTGTGCATACAGACGTGGCTACTTCATCAACAATAAACAGGATGGAGAAAGTTACAAGAACCCAGGGAAACCAGAT

Ensembl | nº de acceso humano

ENSG00000166086

Nº de acceso NCBI

NM_032801

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... JAM3(83700) , JAM3(83700)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xudong Li et al.
International journal of molecular medicine, 42(5), 2923-2929 (2018-09-19)
As a common type of renal cancer, renal cell carcinoma (RCC) has a high annual mortality rate. The incidence of RCC has been increasing in China and worldwide. A large number cases of RCC are diagnosed at late stages, often
SongNan Hao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(6), 5675-5687 (2014-03-04)
This study aims to investigate lymphatic metastasis-related genes in non-small cell lung carcinomas (NSCLC). NSCLC tissue was analyzed for expression of junctional adhesion molecule-C (JAM-C) protein. Our data revealed novel associations between JAM-C overexpression in primary tumors and lymphatic microvessel
Matina Economopoulou et al.
Thrombosis and haemostasis, 114(6), 1241-1249 (2015-08-28)
In proliferative retinopathies, like proliferative diabetic retinopathy and retinopathy of prematurity (ROP), the hypoxia response is sustained by the failure of the retina to revascularise its ischaemic areas. Non-resolving retina ischaemia/hypoxia results in upregulation of pro-angiogenic factors and pathologic neovascularisation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico