Saltar al contenido
Merck

EHU016141

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCATCGCACAGCAACATTACTGGCATTGTGGAAGTGATCCTTGGGGAAACCAAGGCCTATGTCTTCTTTGAGAAGGACTTTGGGGACATGCACTCCTATGTGCGAAGCCGGAAGAGGCTGCGGGAAGAGGAAGCCGCCCGGCTCTTCAAGCAGATTGTCTCCGCCGTCGCCCACTGCCACCAGTCAGCCATCGTGCTGGGGGACCTGAAGCTTAGGAAGTTCGTCTTCTCCACGGAGGAGAGAACCCAGCTTAGACTAGAAAGTCTAGAAGACACACACATAATGAAGGGGGAAGATGATGCTTTGTCAGACAAACATGGCTGCCCAGCCTACGTGAGCCCTGAGATCCTCAACACCACTGGGACCTACTCCGGAAAGGCTGCGGACGTTTGGAGCCTGGGGGTGATGCTCTACACCCTTCTGGTTGGACGATACCCCTTCCATGACTCAGACCCCAGTGCCCTTTTCTCCAAAATTCGGCGTGGACAGTTCTGCATTCCTGAGCACA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chiara Niespolo et al.
Frontiers in immunology, 11, 574046-574046 (2020-12-18)
The pseudokinase TRIB1 controls cell function in a range of contexts, by regulating MAP kinase activation and mediating protein degradation via the COP1 ubiquitin ligase. TRIB1 regulates polarization of macrophages and dysregulated Trib1 expression in murine models has been shown
Ying Ye et al.
Frontiers in physiology, 8, 789-789 (2017-11-28)
Hepatocellular carcinoma (HCC) is a common malignancy associated with a high risk of recurrence and metastasis and a poor prognosis. Here, we examined the involvement of the pseudokinase Tribbles 1 (TRIB1), a scaffold protein associated with several malignancies, in HCC

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico