Saltar al contenido
Merck

EHU013041

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM4A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACTGCAGGCCAGAAAGTCATTAGCAAGCATAAGAACGGGCGCTTCTACCAGTGTGAAGTGGTCAGGCTCACCACCGAGACCTTCTATGAAGTCAACTTTGATGATGGCTCCTTCAGCGACAATCTTTATCCTGAGGACATAGTGAGCCAGGACTGTCTCCAGTTTGGTCCTCCTGCTGAAGGGGAAGTGGTCCAAGTGAGATGGACAGACGGCCAAGTCTATGGAGCCAAGTTTGTGGCCTCCCACCCTATCCAAATGTACCAGGTGGAGTTTGAGGATGGCTCACAACTTGTGGTTAAGAGAGATGATGTATACACACTGGATGAAGAGCTTCCCAAGAGAGTCAAATCTAGACTGTCAGTAGCCTCAGACATGCGCTTCAATGAGATTTTCACAGAGAAAGAGGTTAAGCAAGAAAAGAAACGGCAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Haiyu Zhang et al.
Archives of biochemistry and biophysics, 684, 108334-108334 (2020-03-17)
Emerging evidence shows that histone modification and its related regulators are involved in the progression and chemoresistance of ovarian cancer (OC) cells. Our present study found that the expression of Jumonji C domain-containing 2A (JMJD2A), while not JMJD2B or JMJD2C
Antonio Pezone et al.
Nucleic acids research, 48(16), 8943-8958 (2020-07-23)
The epithelial-to-mesenchymal transition (EMT) is a complex transcriptional program induced by transforming growth factor β1 (TGF-β1). Histone lysine-specific demethylase 1 (LSD1) has been recognized as a key mediator of EMT in cancer cells, but the precise mechanism that underlies the
Yi Su et al.
BMC cancer, 17(1), 477-477 (2017-07-12)
Jumonji C domain 2A (JMJD2A), as a histone demethylases, plays a vital role in tumorigenesis and progression. But, its functions and underlying mechanisms of JMJD2A in nasopharyngeal carcinoma (NPC) metabolism are remained to be clarified. In this study, we investigated
Tadahiko Nakagawa et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 23(3), 426-436 (2019-11-05)
Jumonji domain-containing protein 2A (JMJD2A) of the JMJD2 family of histone lysine demethylases has been implicated in tumorigenesis. However, its expression and role in gastric cancer (GC) drug resistance remain unknown. Here, we investigated the role of JMJD2A in GC

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico