Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU011701

Sigma-Aldrich

MISSION® esiRNA

targeting human CARTPT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGAGAAGGAGCTGATCGAAGCGCTGCAAGAAGTCTTGAAGAAGCTCAAGAGTAAACGTGTTCCCATCTATGAGAAGAAGTATGGCCAAGTCCCCATGTGTGACGCCGGTGAGCAGTGTGCAGTGAGGAAAGGGGCAAGGATCGGGAAGCTGTGTGACTGTCCCCGAGGAACCTCCTGCAATTCCTTCCTCCTGAAGTGCTTATGAAGGGGCGTCCATTCTCCTCCATACATCCCCATCCCTCTACTTTCCCCAGAGGACCACACCTTCCTCCCTGGAGTTTGGCTTAAGCAACAGATAAAGTTTTTATTTTCCTCTGAAGGGAAAGGGCTCTTTTCCTGCTGTTTCAAAAATAAAAGAACACATTAGATGTTACTGTGTGAAGAATAATGCCTTGTATGGTGTTGATACGTGTGTGAAGTATTCTTATTTTATTTGTCTGACAAACTCTTGTGTACCTTTGTGTAAAGAAGGGAAGCTTTGTTTGAAAATTGTATTTTTGTATGTGGCATGGCAGAAT

Ensembl | nº de acceso humano

ENSG00000164326

Nº de acceso NCBI

NM_004291

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CARTPT(9607) , CARTPT(9607)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

L Shcherbina et al.
Molecular and cellular endocrinology, 447, 52-60 (2017-02-27)
Impaired beta-cell function is key to the development of type 2 diabetes. Cocaine- and amphetamine-regulated transcript (CART) is an islet peptide with insulinotropic and glucagonostatic properties. Here we studied the role of endogenous CART in beta-cell function. CART silencing in
Ji-Yao Li et al.
Journal of neurophysiology, 121(3), 928-939 (2019-01-17)
Hyperphagia is common in diabetes and may worsen hyperglycemia and diabetic complications. The responsible mechanisms are not well understood. The hypothalamus is a key center for the control of appetite and energy homeostasis. The ventromedial nucleus (VMH) and arcuate nucleus
Shin J Lee et al.
Cell reports, 30(6), 2028-2039 (2020-02-13)
The vagus nerve conveys gastrointestinal cues to the brain to control eating behavior. In obesity, vagally mediated gut-brain signaling is disrupted. Here, we show that the cocaine- and amphetamine-regulated transcript (CART) is a neuropeptide synthesized proportional to the food consumed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico