Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU009531

Sigma-Aldrich

MISSION® esiRNA

targeting human PLA2G4A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGGCCTTGGTGAGTGATTCAGCTTTATTCAATACCAGAGAAGGACGTGCTGGGAAGGTACACAACTTCATGCTGGGCTTGAATCTCAATACATCTTATCCACTGTCTCCTTTGAGTGACTTTGCCACACAGGACTCCTTTGATGATGATGAACTGGATGCAGCTGTAGCAGATCCTGATGAATTTGAGCGAATATATGAGCCTCTGGATGTCAAAAGTAAAAAGATTCATGTAGTGGACAGTGGGCTCACATTTAACCTGCCGTATCCCTTGATACTGAGACCTCAGAGAGGGGTTGATCTCATAATCTCCTTTGACTTTTCTGCAAGGCCAAGTGACTCTAGTCCTCCGTTCAAGGAACTTCTACTTGCAGAAAAGTGGGCTAAAATGAACAAGCTCCCCTTTCCAAAGATTGATCCTTATGTGTTTGATCGGGAAGGGCTGAAGGAGTGCTATGTCTTTAAACCCAAGAATCCTGATATGGAGAAAGATTGCCCAACCATCATCCACTTTGTTCTGGCCAACATCA

Ensembl | nº de acceso humano

ENSG00000116711

Nº de acceso NCBI

NM_024420

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PLA2G4A(5321) , PLA2G4A(5321)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nikos Koundouros et al.
Cell, 181(7), 1596-1611 (2020-06-20)
Oncogenic transformation is associated with profound changes in cellular metabolism, but whether tracking these can improve disease stratification or influence therapy decision-making is largely unknown. Using the iKnife to sample the aerosol of cauterized specimens, we demonstrate a new mode
Chinmoy Sarkar et al.
Autophagy, 16(3), 466-485 (2019-06-27)
Lysosomal membrane permeabilization (LMP) is observed under many pathological conditions, leading to cellular dysfunction and death. However, the mechanisms by which lysosomal membranes become leaky in vivo are not clear. Our data demonstrate that LMP occurs in neurons following controlled
Dennis Y Chuang et al.
Journal of neuroinflammation, 12, 199-199 (2015-11-02)
Oxidative stress and inflammation are important factors contributing to the pathophysiology of numerous neurological disorders, including Alzheimer's disease, Parkinson's disease, acute stroke, and infections of the brain. There is well-established evidence that proinflammatory cytokines and glutamate, as well as reactive

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico