Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU008151

Sigma-Aldrich

MISSION® esiRNA

targeting human FABP3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCCTAGCCCAGCATCACTATGGTGGACGCTTTCCTGGGCACCTGGAAGCTAGTGGACAGCAAGAATTTCGATGACTACATGAAGTCACTCGGTGTGGGTTTTGCTACCAGGCAGGTGGCCAGCATGACCAAGCCTACCACAATCATCGAAAAGAATGGGGACATTCTCACCCTAAAAACACACAGCACCTTCAAGAACACAGAGATCAGCTTTAAGTTGGGGGTGGAGTTCGATGAGACAACAGCAGATGACAGGAAGGTCAAGTCCATTGTGACACTGGATGGAGGGAAACTTGTTCACCTGCAGAAATGGGACGGGCAAGAGACCACACTTGTGCGGGAGCTAATTGATGGAAAACTCATCCTGACACTCACCCACGGCACTGCAGTTTGCACTCGCACTTATGAGAAAGAGGCATGACCTGACTGCACTGT

Ensembl | nº de acceso humano

ENSG00000121769

Nº de acceso NCBI

NM_004102

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FABP3(2170) , FABP3(2170)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Seung-Min Lee et al.
Nature communications, 11(1), 5661-5661 (2020-11-11)
Sarcopenia is characterized by decreased skeletal muscle mass and function with age. Aged muscles have altered lipid compositions; however, the role and regulation of lipids are unknown. Here we report that FABP3 is upregulated in aged skeletal muscles, disrupting homeostasis
Vadim Le Joncour et al.
EMBO molecular medicine, 11(6) (2019-05-10)
The current clinical care of glioblastomas leaves behind invasive, radio- and chemo-resistant cells. We recently identified mammary-derived growth inhibitor (MDGI/FABP3) as a biomarker for invasive gliomas. Here, we demonstrate a novel function for MDGI in the maintenance of lysosomal membrane

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico