Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU007651

Sigma-Aldrich

MISSION® esiRNA

targeting human PDK4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGAGACTCGCCAACATTCTGAAGGAAATTGATATCCTCCCGACCCAATTAGTAAATACCTCTTCAGTGCAATTGGTTAAAAGCTGGTATATACAGAGCCTGATGGATTTGGTGGAATTCCATGAGAAAAGCCCAGATGACCAGAAAGCATTATCAGACTTTGTAGATACACTCATCAAAGTTCGAAATAGACACCATAATGTAGTCCCTACAATGGCACAAGGAATCATAGAGTATAAAGATGCCTGTACAGTTGACCCAGTCACCAATCAAAATCTTCAATATTTCTTGGATCGATTTTACATGAACCGTATTTCTACTCGGATGCTGATGAACCAGCACATTCTTATATTTAGTGACTCACAGACAGGAAACCCAAGCCACATTGGAAGCATTGATCCTAACTGTGATGTGGTAGCAGTGGTCCAAGATGCCTTTGAGTGTTCAAGGATGCTCTGTGATCAGTATTATTTATCATCTCCAGAATTAAAGCTTACACAAGTGAATGGAAAATTTCCAGACCAACCAATTCACA

Ensembl | nº de acceso humano

ENSG00000004799

Nº de acceso NCBI

NM_002612

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PDK4(5166) , PDK4(5166)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JUU
IDU
NRR
RPR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yongchang Miao et al.
Cancer medicine, 9(19), 7231-7243 (2020-08-12)
Gastric cancer (GC) is one of the most deadly malignancies at global scale, and is particularly common in eastern Asia. MicroRNA-5683 (miR-5683) was confirmed to be downregulated in GC by analyzing data from the Cancer Genome Atlas. We packaged miR-5683-mimics
D Leclerc et al.
British journal of cancer, 116(7), 930-936 (2017-02-17)
Cancer cells maintain high rates of glycolysis. Pyruvate dehydrogenase kinases (PDK) contribute to this phenomenon, which favours apoptosis resistance and cellular transformation. We previously reported upregulation of PDK4 in normal mucosa of colorectal cancer (CRC) patients compared with controls and
Xiaohui Liu et al.
Scientific reports, 7(1), 8474-8474 (2017-08-18)
Pyruvate dehydrogenase kinase (PDK) is known as a gatekeeper directing the carbon flux into glycolysis via inhibition of the pyruvate dehydrogenase complex. During syncytialization of placental trophoblasts, both ATP production and oxygen consumption are increased to meet enhanced energetic demands
Peng Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 3924-3935 (2018-03-06)
Prostate cancer (PCa) represents one of the most common solid neoplasms, and metastasis is the second leading cause of death in adult males. Anoikis is a programmed cell death that is induced upon cell detachment from the extracellular matrix (ECM)
Yukihiro Tambe et al.
Molecular carcinogenesis, 58(10), 1726-1737 (2019-05-21)
Phosphorylation of pyruvate dehydrogenase by pyruvate dehydrogenase kinase 4 (PDK4) 4 inhibits its ability to induce a glycolytic shift. PDK4 expression is frequently upregulated in various cancer tissues, with its elevation being critical for the induction of the Warburg effect.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico