Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU007381

Sigma-Aldrich

MISSION® esiRNA

targeting human ONECUT2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCCAGCTGGAAGAAATCAACACCAAAGAGGTGGCCCAGCGCATCACAGCGGAGCTGAAGCGCTACAGTATCCCCCAGGCGATCTTTGCGCAGAGGGTGCTGTGCCGGTCTCAGGGGACTCTCTCCGACCTGCTCCGGAATCCAAAACCGTGGAGTAAACTCAAATCTGGCAGGGAGACCTTCCGCAGGATGTGGAAGTGGCTTCAGGAGCCCGAGTTCCAGCGCATGTCCGCCTTACGCCTGGCAGCGTGCAAACGCAAAGAGCAAGAACCAAACAAAGACAGGAACAATTCCCAGAAGAAGTCCCGCCTGGTGTTCACTGACCTCCAACGCCGAACACTCTTCGCCATCTTCAAGGAGAACAAACGCCCGTCAAAGGAGATGCAGATCACCATTTCCCAGCAGCTGGGCCTGGAGCTCACAACCGTCAGCAACTTCTTCATGAACGCCCGGCGCCGCAGCCTGGAGAAGTGGCAAGACGATCTGAGCACAGGGGGCTCCTCGTCCACCTCCAGCACGTGTACCAAAGCATGATGG

Ensembl | nº de acceso humano

ENSG00000119547

Nº de acceso NCBI

NM_004852

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ONECUT2(9480) , ONECUT2(9480)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

G-H Wang et al.
European review for medical and pharmacological sciences, 24(18), 9378-9390 (2020-10-06)
Gastric cancer is a common malignancy, with high metastasis and poor prognosis. Our purpose was to explore potential molecular mechanisms of gastric cancer. A total of 10 pairs of gastric cancer tissues and adjacent normal gastric tissues were collected for
Meng Shen et al.
Cancer research, 79(14), 3608-3621 (2019-05-24)
Cancer-secreted, extracellular vesicle (EV)-encapsulated miRNAs enable cancer cells to communicate with each other and with noncancerous cells in tumor pathogenesis and response to therapies. Here, we show that treatment with a sublethal dose of chemotherapeutic agents induces breast cancer cells
Haiyang Guo et al.
Nature communications, 10(1), 278-278 (2019-01-19)
Neuroendocrine prostate cancer (NEPC), a lethal form of the disease, is characterized by loss of androgen receptor (AR) signaling during neuroendocrine transdifferentiation, which results in resistance to AR-targeted therapy. Clinically, genomically and epigenetically, NEPC resembles other types of poorly differentiated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico