Saltar al contenido
Merck

EHU005961

Sigma-Aldrich

MISSION® esiRNA

targeting human ESPL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGATCAAGGCATCAGCTGTCCTGAGCAAGAGTATGGAGGCACCATCACCCCCACTTCGGGCATTGTATGAGAGCTGCCAGTTCTTCCTTTCAGGCCTGGAACGAGGCACCAAGAGGCGCTATAGACTTGATGCCATTCTGAGCCTCTTTGCTTTTCTTGGAGGGTACTGCTCTCTTCTGCAGCAGCTGCGGGATGATGGTGTGTATGGGGGCTCCTCCAAGCAACAGCAGTCTTTTCTTCAGATGTACTTTCAGGGACTTCACCTCTACACTGTGGTGGTTTATGACTTTGCCCAAGGCTGTCAGATAGTTGATTTGGCTGACCTGACCCAACTAGTGGACAGTTGTAAATCTACCGTTGTCTGGATGCTGGAGGCCTTAGAGGGCCTGTCGGGCCAAGAGCTGACGGACCACATGGGGATGACCGCTTCTTACACC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Claudia Galofré et al.
Scientific reports, 10(1), 9152-9152 (2020-06-06)
Tetraploidy, a common feature in cancer, results in the presence of extra centrosomes, which has been associated with chromosome instability (CIN) and aneuploidy. Deregulation in the number of centrosomes triggers tumorigenesis. However, how supernumerary centrosomes evolve during the emergence of
Menuka Karki et al.
Nature communications, 8, 15803-15803 (2017-06-14)
The spindle assembly checkpoint (SAC) delays mitotic progression until all sister chromatid pairs achieve bi-orientation, and while the SAC can maintain mitotic arrest for extended periods, moderate delays in mitotic progression have significant effects on the resulting daughter cells. Here

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico