Saltar al contenido
Merck

EHU005221

Sigma-Aldrich

MISSION® esiRNA

targeting human ASAH2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTTCATCATGGCAGAACCTGATGGGTCCAATCGAACAGTGTTTGTCAGCATCGACATAGGCATGGTATCACAAAGGCTCAGGCTGGAGGTCCTGAACAGACTGCAGAGTAAATATGGCTCCCTGTACAGAAGAGATAATGTCATCCTGAGTGGCACTCACACTCATTCAGGTCCTGCAGGATATTTCCAGTATACCGTGTTTGTAATTGCCAGTGAAGGATTTAGCAATCAAACTTTTCAGCACATGGTCACTGGTATCTTGAAGAGCATTGACATAGCACACACAAATATGAAACCAGGCAAAATCTTCATCAATAAAGGAAATGTGGATGGTGTGCAGATCAACAGAAGTCCGTATTCTTACCTTCAAAATCCGCAGTCAGAGAGAGCAAGGTATTCTTCAAATACAGACAAGGAAATGATAGTTTTGAAAATGGTAGATTTGAATGGAGATGACTTGGGCCTTATCAGCTGGTTTGCCATCCACCCGGTCAGCATGAACAACAGTAACCATCTTGTAAACAGTGACAATGTGGGCTATGCAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nicolas Coant et al.
Oncogene, 37(28), 3852-3863 (2018-04-18)
Despite advances in the field, colorectal cancer (CRC) remains a leading cause of cancer-related mortality worldwide. Research into bioactive sphingolipids over the past two decades has played an important role in increasing our understanding of the pathogenesis and therapeutics of
Fen Luo et al.
Endocrine journal, 64(8), 767-776 (2017-07-05)
Neutral ceramidase (NCDase) is a class of ceramidases, a key enzyme in ceramide degradation. Recently, it was observed that NCDase activity was suppressed by saturated fatty acids to increase ceramide content in rat muscle. However, little is known about its

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico