Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU003671

Sigma-Aldrich

MISSION® esiRNA

targeting human FUT4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGTACCTGCTTTTCCTCGACCGCAACCCCGCGGTCTATCGCCGCTACTTCCACTGGCGCCGGAGCTACGCTGTCCACATCACCTCCTTCTGGGACGAGCCTTGGTGCCGGGTGTGCCAGGCTGTACAGAGGGCTGGGGACCGGCCCAAGAGCATACGGAACTTGGCCAGCTGGTTCGAGCGGTGAAGCCGCGCTCCCCTGGAAGCGACCCAGGGGAGGCCAAGTTGTCAGCTTTTTGATCCTCTACTGTGCATCTCCTTGACTGCCGCATCATGGGAGTAAGTTCTTCAAACACCCATTTTTGCTCTATGGGAAAAAAACGATTTACCAATTAATATTACTCAGCACAGAGATGGGGGCCCGGTTTCCATATTTTTTGCACAGCTAGCAATTGGGCTCCCTTTGCTGCTGATGGGCATCATTGTTTAGGGGTGAAGGAGG

Ensembl | nº de acceso humano

ENSG00000196371

Nº de acceso NCBI

NM_002033

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FUT4(2526) , FUT4(2526)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qin Zheng et al.
Cell death and differentiation, 24(12), 2161-2172 (2017-09-16)
Successful embryo implantation requires the establishment of a receptive endometrium. Poor endometrial receptivity has generally been considered as a major cause of infertility. Protein glycosylation is associated with many physiological and pathological processes. The fucosylation is catalyzed by the specific
X Yang et al.
Cell death & disease, 4, e735-e735 (2013-07-28)
Epithelial-mesenchymal transition (EMT) is a crucial step in tumor progression and has an important role during cancer invasion and metastasis. Although fucosyltransferase IV (FUT4) has been implicated in the modulation of cell migration, invasion and cancer metastasis, its role during
Xiu Shan et al.
IUBMB life, 72(5), 942-956 (2020-01-22)
Malignant melanoma is one of the most aggressive human tumor types, mainly due to its high invasion capability, metastatic properties, and the absence of effective treatments. Glycosylation serves a pivotal role in the migration and invasion of melanoma. However, differences
Yang Li et al.
Cell death & disease, 8(6), e2892-e2892 (2017-06-24)
Metastasis is a multistep molecular network process, which is the major cause of death in patients with colorectal cancer (CRC). MicroRNAs (miRNAs) play pivotal roles in tumorigenesis as either tumor suppressors or oncogenes. Increased expression of fucosyltransferase4 (FUT4) has been
Xiaobin Feng et al.
Gene, 578(2), 232-241 (2015-12-25)
Fucosylation is the final step in the glycosylation machinery, which produces glycans involved in tumor multidrug resistance development. MicroRNAs (miRNAs) are endogenous negative regulators of gene expression and have been implicated in most cellular processes of tumors, including drug resistance.
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico