Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU002251

Sigma-Aldrich

MISSION® esiRNA

targeting human TBC1D5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TATAAACAGGGCATGCACGAACTGTTAGCACCTATAGTCTTTGTCCTTCACTGTGACCACCAAGCTTTTCTACATGCCAGTGAGTCTGCACAGCCCAGGCAAGAAATGAAAACTGTCTTGAACCCTGAGTATCTGGAACATGATGCCTATGCAGTGTTCTCACAACTTATGGAAACTGCTGAACCTTGGTTTTCAACTTTTGAGCATGATGGTCAGAAGGGGAAAGAAACACTGATGACTCCCATTCCCTTTGCTAGACCACAAGATTTAGGGCCAACAATTGCTATTGTTACTAAAGTCAACCAGATCCAGGATCATCTACTGAAGAAGCATGATATTGAGCTTTACATGCACTTGAACAGACTAGAAATTGCACCACAGATATATGGGTTAAGGTGGGTGCGGCTGCTATTTGGACGAGAGTTCCCCCTGCAGGACCTTCTGGTGGTCTGGGATGCCTTGTTTGCAGACGGCCTCAGCCTGGGTTTAGTAGATTATATCTTCGTAGCCATGTTACTTTACATCCGAGATGCTTTGATCTCTAGTAACTACCAGACCTGTCTCGGC

Ensembl | nº de acceso humano

ENSG00000131374

Nº de acceso NCBI

NM_014744

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TBC1D5(9779) , TBC1D5(9779)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5
Jian Xie et al.
Cell reports, 31(10), 107750-107750 (2020-06-11)
During virus entry, human papillomaviruses are sorted by the cellular trafficking complex, called retromer, into the retrograde transport pathway to traffic from the endosome to downstream cellular compartments, but regulation of retromer activity during HPV entry is poorly understood. Here

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico