Saltar al contenido
Merck

EHU002061

Sigma-Aldrich

MISSION® esiRNA

targeting human TAAR1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGCCTCCATTTTCCATTTGTCTTTCATCTCCATTGACCGCTACTATGCTGTGTGTGATCCACTGAGATATAAAGCCAAGATGAATATCTTGGTTATTTGTGTGATGATCTTCATTAGTTGGAGTGTCCCTGCTGTTTTTGCATTTGGAATGATCTTTCTGGAGCTAAACTTCAAAGGCGCTGAAGAGATATATTACAAACATGTTCACTGCAGAGGAGGTTGCTCTGTCTTCTTTAGCAAAATATCTGGGGTACTGACCTTTATGACTTCTTTTTATATACCTGGATCTATTATGTTATGTGTCTATTACAGAATATATCTTATCGCTAAAGAACAGGCAAGATTAATTAGTGATGCCAATCAGAAGCTCCAAATTGGATTGGAAATGAAAAATGGAATTTCACAAAGCAAAGAAAGGAAAGCTGTGAAGACATTGGGGAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mallory S Pitts et al.
Histochemistry and cell biology, 152(2), 155-166 (2019-05-22)
Trace amine-associated receptors are G protein-coupled receptors of which TAAR1 is the most well-studied. Recently, Vattai et al. (J Cancer Res Clin Oncol 143:1637-1647 https://doi.org/10.1007/s00432-017-2420-8 , 2017) reported that expression of TAAR1 may be a marker of breast cancer (BC)
D Almeida-Santos et al.
Journal of molecular neuroscience : MN, 71(3), 625-637 (2020-08-21)
The choroid plexus (CP) constitutes a barrier between the blood and the cerebrospinal fluid (CSF) which regulates the exchange of substances between these two fluids through mechanisms that are not completely understood. Polyamines as spermine, spermidine and putrescine are produced
Uma Sriram et al.
Journal of leukocyte biology, 99(1), 213-223 (2015-08-26)
The novel transmembrane G protein-coupled receptor, trace amine-associated receptor 1 (TAAR1), represents a potential, direct target for drugs of abuse and monoaminergic compounds, including amphetamines. For the first time, our studies have illustrated that there is an induction of TAAR1

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico