Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU001531

Sigma-Aldrich

MISSION® esiRNA

targeting human GPC3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTCTTACTGCCAGGGACTGATGATGGTTAAACCCTGTGGCGGTTACTGCAATGTGGTCATGCAAGGCTGTATGGCAGGTGTGGTGGAGATTGACAAGTACTGGAGAGAATACATTCTGTCCCTTGAAGAACTTGTGAATGGCATGTACAGAATCTATGACATGGAGAACGTACTGCTTGGTCTCTTTTCAACAATCCATGATTCTATCCAGTATGTCCAGAAGAATGCAGGAAAGCTGACCACCACTATTGGCAAGTTATGTGCCCATTCTCAACAACGCCAATATAGATCTGCTTATTATCCTGAAGATCTCTTTATTGACAAGAAAGTATTAAAAGTTGCTCATGTAGAACATGAAGAAACCTTATCCAGCCGAAGAAGGGAACTAATTCAGAAGTTGAAGTCTTTCATCAGCTTCTATAGTGCTTTGCCTGGCTACAT

Ensembl | nº de acceso humano

ENSG00000147257

Nº de acceso NCBI

NM_004484

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GPC3(2719) , GPC3(2719)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiubin Fei et al.
Oncology letters, 15(6), 9081-9086 (2018-05-29)
Lung cancer is a major cause of death worldwide, and non-small cell lung cancer (NSCLC) is the most common type of lung cancer. The aim of this study was to investigate whether miR-96 mediated the invasion and metastasis of NSCLC
Weitong Sun et al.
Biomaterials science, 5(12), 2468-2479 (2017-11-07)
Hepatocellular carcinoma (HCC) is one of the most common malignancies imposing a serious threat to human health worldwide. To date, the effect of HCC chemotherapy has been limited due to drug resistance. Combination therapy of chemotherapeutic drugs and siRNA represents
Pei Hu et al.
OncoTargets and therapy, 11, 193-200 (2018-01-31)
Autophagy plays an important role in the growth and survival of hepatocellular carcinoma (HCC) cells through several target proteins or signaling pathways. Glypican-3 (GPC3) is a new reliable HCC marker, which is involved in tumor growth in HCC, primarily mediated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico