Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU001321

Sigma-Aldrich

MISSION® esiRNA

targeting human MIOX

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACTCCACCTTCCAGGACAACCCTGACCTCCAGGATCCTCGATACAGCACAGAGCTCGGGATGTATCAGCCCCACTGTGGGCTCGACAGGGTCCTCATGTCCTGGGGCCATGATGAGTACATGTACCAGGTGATGAAGTTTAACAAGTTCTCACTGCCCCCTGAGGCTTTCTACATGATCCGGTTCCACTCCTTCTACCCCTGGCACACGGGCCGCGACTACCAGCAGCTGTGCAGCCAGCAGGACCTGGCCATGCTGCCCTGGGTGCGGGAGTTCAACAAGTTCGACCTCTACACCAAGTGCCCGGACCTGCCGGACGTGGACAAGCTGCGGCCCTACTACCAGGGGCTCATTGACAAGTACTGCCCTGGCATCCTGAGCTGGTGACCCTCCTGCCACCCAAGCTGCTGCTGGACCTAGGCCTGGCCCTCCGCCTGCCTGGAGAGGCCTGGCCCTGGGCAAACAGCCGCCATCAGGGTTCACCTCGGTGGGGGACCCCACTCACCCCCTTAGGGTCGCCACCCCTCACGGCAACTTGTGCCTGGCGTCAATAAAGACCTGGAAGGATGTTGTGCT

Ensembl | nº de acceso humano

ENSG00000100253

Nº de acceso NCBI

NM_017584

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MIOX(55586) , MIOX(55586)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tatsuya Tominaga et al.
The Journal of biological chemistry, 291(3), 1348-1367 (2015-11-19)
The kidney is one of the target organs for various metabolic diseases, including diabetes, metabolic syndrome, and obesity. Most of the metabolic studies underscore glomerular pathobiology, although the tubulo-interstitial compartment has been underemphasized. This study highlights mechanisms concerning the pathobiology
Isha Sharma et al.
Biomedicines, 8(7) (2020-07-28)
Obesity is associated with perturbations in cellular energy homeostasis and consequential renal injury leading to chronic renal disease (CKD). Myo-inositol oxygenase (MIOX), a tubular enzyme, alters redox balance and subsequent tubular injury in the settings of obesity. Mechanism(s) for such

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico