Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU000091

Sigma-Aldrich

MISSION® esiRNA

targeting human DRD1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTCTGATGGAAATGCCACTTCCCTGGCTGAGACCATAGACAACTGTGACTCCAGCCTCAGCAGGACATATGCCATCTCATCCTCTGTAATAAGCTTTTACATCCCTGTGGCCATCATGATTGTCACCTACACCAGGATCTACAGGATTGCTCAGAAACAAATACGGCGCATTGCGGCCTTGGAGAGGGCAGCAGTCCACGCCAAGAATTGCCAGACCACCACAGGTAATGGAAAGCCTGTCGAATGTTCTCAACCGGAAAGTTCTTTTAAGATGTCCTTCAAAAGAGAAACTAAAGTCCTGAAGACTCTGTCGGTGATCATGGGTGTGTTTGTGTGCTGTTGGCTACCTTTCTTCATCTTGAACTGCATTTTGCCCTTCTGTGGGTCTGGGGAGACGCAGCCCTTCTGCATTGATTCCAACACCTTTGACGTGTTTGTGTGG

Ensembl | nº de acceso humano

ENSG00000184845

Nº de acceso NCBI

NM_000794

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DRD1(1812) , DRD1(1812)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shengzhi Liu et al.
Cancer research, 78(14), 3865-3876 (2018-05-18)
While bone is a frequent target of breast cancer-associated metastasis, little is known about the effects of tumor-bone interactions on the efficacy of tumor-suppressing agents. Here we examined the effect of two FDA-approved dopamine modulators, fluphenazine and trifluoperazine, on mammary
Kazumasa Minami et al.
Scientific reports, 7, 45686-45686 (2017-04-05)
Dopaminergic signaling plays a critical role in the nervous system, but little is known about its potential role in breast cancer and bone metabolism. A screening of ~1,000 biologically active compounds revealed that a selective agonist of dopamine receptor D1
Fengmin Li et al.
Endocrinology, 156(6), 2211-2221 (2015-04-01)
Sorting nexin 5 (SNX5) belongs to the SNX family, which is composed of a diverse group of proteins that mediate trafficking of plasma membrane proteins, receptors, and transporters. SNX5 is important in the resensitization of the dopamine D1-like receptor (D1R).
Kang Yang et al.
Cellular oncology (Dordrecht), 43(6), 1175-1190 (2020-08-08)
Recent studies have reported important roles of dopamine receptors in the early development and progression of glioblastoma (GBM). Here, we tested the antitumor activity of a Dopamine receptor D1 (DRD1) agonist, either alone or in combination with temozolomide (TMZ) on

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico