Skip to Content
Merck
All Photos(1)

Key Documents

EMU022801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ctgf

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGGAAGTAAGGGACACGAACTCATTAGACTATAACTTGAACTGAGTTGCATCTCATTTTCTTCTGTAAAAACAATTACAGTAGCACATTAATTTAAATCTGTGTTTTTAACTACCGTGGGAGGAACTATCCCACCAAAGTGAGAACGTTATGTCATGGCCATACAAGTAGTCTGTCAACCTCAGACACTGGTTTCGAGACAGTTTACACTTGACAGTTGTTCATTAGCGCACAGTGCCAGAACGCACACTGAGGTGAGTCTCCTGGAACAGTGGAGATGCCAGGAGAAAGAAAGACAGGTACTAGCTGAGGTTATTTTAAAAGCAGCAGTGTGCCTACTTTTTGGAGTGTAACCGGGGAGGGAAATTATAGCATGCTTGCAGACAGACCTGCTCTAGCGAGAGCTGAGCATGTGTCCTCCACTAGATGAGGCTGAGTCCAGCTGT

Ensembl | mouse accession no.

ENSMUSG00000019997

NCBI accession no.

NM_010217

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... CTGF(14219) , Ctgf(14219)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

James Hutchenreuther et al.
The Journal of investigative dermatology, 135(11), 2805-2813 (2015-07-15)
Metastatic melanoma has an extremely poor prognosis with few durable remissions. The secreted matricellular protein connective tissue growth factor (CCN2) is overexpressed in cancers including melanoma and may represent a viable therapeutic target. However, the mechanism underlying the contribution of
Tian Tian et al.
American journal of cancer research, 5(5), 1823-1830 (2015-07-16)
Glioblastoma multiforme (GBM) is the deadliest and most common form of malignant primary brain tumor in humans. However, until now, little is known about the glioma genesis and progression at the molecular level. Here we report that overexpression of sine
Chien-Huang Lin et al.
PloS one, 9(8), e104746-e104746 (2014-08-15)
CXCL12 (stromal cell-derived factor-1, SDF-1) is a potent chemokine for homing of CXCR4+ fibrocytes to injury sites of lung tissue, which contributes to pulmonary fibrosis. Overexpression of connective tissue growth factor (CTGF) plays a critical role in pulmonary fibrosis. In
Yunzhuo Ren et al.
Drug design, development and therapy, 9, 4155-4171 (2015-08-11)
Transforming growth factor-β1 (TGF-β1) plays an important role in the pathogenesis and progression of chronic kidney disease. Connective tissue growth factor (CTGF) is a critical fibrogenic mediator of TGF-β1. Mammalian sirtuin 1 (Sirt1) is reported to attenuate renal fibrosis by

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service