Skip to Content
Merck
All Photos(1)

Documents

EHU149801

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAGCAGTGGAGATGGATTTGAAGAAGGTCTGACTGTGGCCACAGTAGTGGAGTCAGCCCTTTGTGCTCTGAGAAATTGTATAGCCTTCATGCCCCCAGCGGAACAGAACCCGGCCCCCCTGGCCCAGCCAGAGCCTCTGGTGTGGGTCAGCAAGTGGGTTGACTACTCCAATAAGTTCGGCTTTGGGTATCAACTGTCCAGCCGCCGTGTGGCTGTGCTCTTCAACGATGGCACACATATGGCCCTGTCGGCCAACAGAAAGACTGTGCACTACAATCCCACCAGCACAAAGCACTTCTCCTTCTCCGTGGGTGCTGTGCCCCGGGCCCTGCAGCCTCAGCTGGGTATCCTGCGGTACTTCGCCTCCTACATGGAGCAGCACCTCATGAAGGGTGGAGATCTGCCCAGTGTGGAAGAGGTAGAGGTACCTGCTCCGCCCTTGCTGCTGCAGTGGGTCAAGACGGATCAGGCTCTCCTCATGCTGTTTAGTGATGGCACTGTCCAGGTGAACTTCTACGGGGACCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mahamat Babagana et al.
Molecular carcinogenesis, 59(1), 5-14 (2019-10-02)
The activation of oncogenic mitogen-activated protein kinase cascade via mutations in BRAF is often observed in human melanomas. Targeted inhibitors of BRAF (BRAFi), alone or as a part of a combination therapy, offer a significant benefit to such patients. Unfortunately
Cecilia Aquino Perez et al.
Cells, 9(6) (2020-06-25)
Polo-like kinases play essential roles in cell cycle control and mitosis. In contrast to other members of this kinase family, PLK3 has been reported to be activated upon cellular stress including DNA damage, hypoxia and osmotic stress. Here we knocked
Chellappagounder Thangavel et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(21), 5468-5482 (2014-08-29)
Perturbations in the retinoblastoma pathway are over-represented in advanced prostate cancer; retinoblastoma loss promotes bypass of first-line hormone therapy. Conversely, preliminary studies suggested that retinoblastoma-deficient tumors may become sensitized to a subset of DNA-damaging agents. Here, the molecular and in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service