Skip to Content
Merck
All Photos(1)

Key Documents

EHU136211

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGAGGGCACATGCAGTAGATATTAATGGAAATCAAGTGGAGAACCCCATTGACATTGTCATCAATGTTATTGACATGAATGACAACAGACCTGAGTTCTTACACCAGGTTTGGAATGGGACAGTTCCTGAGGGATCAAAGCCTGGAACATATGTGATGACCGTAACAGCAATTGATGCTGACGATCCCAATGCCCTCAATGGGATGTTGAGGTACAGAATCGTGTCTCAGGCTCCAAGCACCCCTTCACCCAACATGTTTACAATCAACAATGAGACTGGTGACATCATCACAGTGGCAGCTGGACTTGATCGAGAAAAAGTGCAACAGTATACGTTAATAATTCAAGCTACAGACATGGAAGGCAATCCCACATATGGCCTTTCAAACACAGCCACGGCCGTCATCACAGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACGTTTTATGGTGAAGTTCCTGAGAACAGGGTAGACATCATAGTAGCTAATCTAACTGTGACCGATAAGGATCAACCCCATACACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hsien-Ming Wu et al.
Oncotarget, 8(3), 4410-4421 (2016-12-30)
More than 25% of patients diagnosed with endometrial carcinoma have invasive primary cancer accompanied by metastases. Growth hormone-releasing hormone (GHRH) plays an important role in reproduction. Here, we examined the effect of a GHRH antagonist on the motility of endometrial
Bo Xu et al.
Nature biotechnology (2018-11-27)
The efficacy of oncolytic herpes simplex virus (oHSV) is limited by rapid viral clearance by innate immune effector cells and poor intratumoral viral spread. We combine two approaches to overcome these barriers: inhibition of natural killer (NK) cells and enhancement
Ciqing Yang et al.
Histochemistry and cell biology, 151(3), 239-248 (2018-09-27)
N-cadherin, a member of the cadherin family, plays an important role in neural development. In addition, N-cadherin has been reported to be crucial in neuronal migration, axonal outgrowth, and axonal path-finding. However, the mechanism underlying the effects of N-cadherin in
Srikanth R Polusani et al.
Journal of cell science, 129(23), 4399-4410 (2016-11-02)
Gap junction proteins (connexins) have crucial effects on cell motility in many systems, from migration of neural crest cells to promotion of metastatic invasiveness. Here, we show that expression of Cx26 (also known as GJB2) in HeLa cells specifically enhances
Maria Jose Dubon et al.
Journal of cellular physiology, 233(1), 201-213 (2017-02-19)
Transforming growth factor-beta (TGF-β) induces the migration and mobilization of bone marrow-derived mesenchymal stem cells (BM-MSCs) to maintain bone homeostasis during bone remodeling and facilitate the repair of peripheral tissues. Although many studies have reported the mechanisms through which TGF-β

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service