Skip to Content
Merck
All Photos(1)

Documents

EHU108531

Sigma-Aldrich

MISSION® esiRNA

targeting human LDHA

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGTCAGCAAGAGGGAGAAAGCCGTCTTAATTTGGTCCAGCGTAACGTGAACATCTTTAAATTCATCATTCCTAATGTTGTAAAATACAGCCCGAACTGCAAGTTGCTTATTGTTTCAAATCCAGTGGATATCTTGACCTACGTGGCTTGGAAGATAAGTGGTTTTCCCAAAAACCGTGTTATTGGAAGCGGTTGCAATCTGGATTCAGCCCGATTCCGTTACCTAATGGGGGAAAGGCTGGGAGTTCACCCATTAAGCTGTCATGGGTGGGTCCTTGGGGAACATGGAGATTCCAGTGTGCCTGTATGGAGTGGAATGAATGTTGCTGGTGTCTCTCTGAAGACTCTGCACCCAGATTTAGGGACTGATAAAGATAAGGAACAGTGGAAAGAGGTTCACAAGCAGGTGGTTGAG

Ensembl | human accession no.

ENSG00000134333

NCBI accession no.

NM_005566

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LDHA(3939) , LDHA(3939)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weiyou Zhu et al.
American journal of translational research, 10(7), 2055-2067 (2018-08-11)
The use of human epidermal growth factor receptor-2 (HER2) as a biomarker for gastric cancer (GC) has greatly helped some patients receive benefit from HER2-targeted therapy. However, the correlation between HER2 and other biochemical markers is unclear. The aim of
Michael Koukourakis et al.
Biochemical and biophysical research communications, 491(4), 932-938 (2017-08-02)
Up-regulation of lactate dehydrogenase LDHA, is a frequent event in human malignancies and relate to poor postoperative outcome. In the current study we examined the hypothesis that LDHA and anaerobic glycolysis, may contribute to the resistance of glioblastoma to radiotherapy
Michael I Koukourakis et al.
Laboratory investigation; a journal of technical methods and pathology, 97(11), 1321-1331 (2017-08-29)
Cooperation of cancer cells with stromal cells, such as cancer-associated fibroblasts (CAFs), has been revealed as a mechanism sustaining cancer cell survival and growth. In the current study, we focus on the metabolic interactions of MRC5 lung fibroblasts with lung
Yong-Jin Kwon et al.
Cells, 9(4) (2020-04-23)
Circadian oscillation is an essential process that influences many physiological and biological mechanisms and a decrease of circadian genes is associated with many diseases such as cancer. Despite many efforts to identify the detailed mechanism for decreasing circadian genes and
L Jin et al.
Oncogene, 36(27), 3797-3806 (2017-02-22)
Metastases remain the major cause of death from cancer. Recent molecular advances have highlighted the importance of metabolic alterations in cancer cells, including the Warburg effect that describes an increased glycolysis in cancer cells. However, how this altered metabolism contributes
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service