Skip to Content
Merck
All Photos(1)

Documents

EHU105871

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGB2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTACGTTCCTCCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCCAATGCTCCTAAAAGGCCACCATCTGCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCAAAAGTGAACACCCTGGCCTATCCATTGGGGATACTGCAAAGAAATTGGGTGAAATGTGGTCTGAGCAGTCAGCCAAAGATAAACAACCATATGAACAGAAAGCAGCTAAGCTAAAGGAGAAATATGAAAAGGATATTGCTGCATATCGTGCCAAGGGCAAAAGTGAAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGAAGAAGAACGAACCAGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGATGAGGAGGAAGAGGATGAAGATGAAGAATAAATGGCTATCCTTTAATGATGCGTGTGGAATGTGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongjuan Li et al.
American journal of cancer research, 8(5), 835-851 (2018-06-12)
Ovarian carcinoma is a fatal malignancy in gynecological malignancies, and the prognosis still remains poor due to the lack of effective therapeutic targets. This study demonstrated that centromere protein U (CENPU) was up-regulated in ovarian cancer. The ectopic expression of
Deokcheol Lee et al.
Scientific reports, 8(1), 9601-9601 (2018-06-27)
Although various surgical procedures have been developed for chronic rotator cuff tear repair, the re-tear rate remains high with severe fat infiltration. However, little is known about the molecular regulation of this process. Mesenchymal stem cells (MSCs) in the intra-muscular
María Cámara-Quílez et al.
Cancers, 12(9) (2020-09-02)
High mobility group box B (HMGB) proteins are overexpressed in different types of cancers such as epithelial ovarian cancers (EOC). We have determined the first interactome of HMGB1 and HMGB2 in epithelial ovarian cancer (the EOC-HMGB interactome). Libraries from the
Cuiping Zhang et al.
Haematologica, 105(3), 573-584 (2019-06-07)
Hematopoietic stem cells provide life-long production of blood cells and undergo self-renewal division in order to sustain the stem cell pool. Homeostatic maintenance of hematopoietic stem cell pool and blood cell production is vital for the organism to survive. We

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service