Skip to Content
Merck
All Photos(1)

Key Documents

EHU104541

Sigma-Aldrich

MISSION® esiRNA

targeting human AKR1C3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATTTGGCACCTATGCACCTCCAGAGGTTCCGAGAAGTAAAGCTTTGGAGGTCACAAAATTAGCAATAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAAAACTCACTGAAGAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATGTCTCTAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGACATAGTGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGTCCATTGGGGTGTCAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yoshitaka Sekine et al.
Oncology letters, 15(3), 3167-3172 (2018-02-13)
Statins have become of interest in research due to their anticancer effects. However, the exact mechanism of their anticancer properties remains unclear. The authors previously reported that statins decrease intracellular cholesterol levels in androgen-independent prostate cancer cells. In de novo
Melanie M Erzinger et al.
PloS one, 11(3), e0150219-e0150219 (2016-03-08)
The chemoprotective properties of sulforaphane (SF), derived from cruciferous vegetables, are widely acknowledged to arise from its potent induction of xenobiotic-metabolizing and antioxidant enzymes. However, much less is known about the impact of SF on the efficacy of cancer therapy
Chengfei Liu et al.
Molecular cancer therapeutics, 16(1), 35-44 (2016-10-30)
Abiraterone suppresses intracrine androgen synthesis via inhibition of CYP17A1. However, clinical evidence suggests that androgen synthesis is not fully inhibited by abiraterone and the sustained androgen production may lead to disease relapse. In the present study, we identified AKR1C3, an
Chengfei Liu et al.
Molecular cancer therapeutics, 18(10), 1875-1886 (2019-07-17)
The mechanisms resulting in resistance to next-generation antiandrogens in castration-resistant prostate cancer are incompletely understood. Numerous studies have determined that constitutively active androgen receptor (AR) signaling or full-length AR bypass mechanisms may contribute to the resistance. Previous studies established that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service