Skip to Content
Merck
All Photos(1)

Key Documents

EHU097551

Sigma-Aldrich

MISSION® esiRNA

targeting human TET3 (1)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTTTGGTTGTTCCTGGAGCATGTACTTCAACGGCTGCAAGTATGCTCGGAGCAAGACACCTCGCAAGTTCCGCCTCGCAGGGGACAATCCCAAAGAGGAAGAAGTGCTCCGGAAGAGTTTCCAGGACCTGGCCACCGAAGTCGCTCCCCTGTACAAGCGACTGGCCCCTCAGGCCTATCAGAACCAGGTGACCAACGAGGAAATAGCGATTGACTGCCGTCTGGGGCTGAAGGAAGGACGGCCCTTCGCGGGGGTCACGGCCTGCATGGACTTCTGTGCCCACGCCCACAAGGACCAGCATAACCTCTACAATGGGTGCACC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liang-Qi Cao et al.
Molecular cancer, 18(1), 148-148 (2019-10-28)
As an important means of communication, exosomes play an important role in the development of hepatocellular carcinoma (HCC). Bioinformatics analysis, dual-luciferase reporter assays, methylation-specific quantitative PCR, and ChIP-PCR analysis were used to gain insight into the underlying mechanism of miR-21
Jie Li et al.
Journal of Cancer, 12(1), 207-216 (2021-01-05)
Background: Berberine, as an alkaloid, has a significant antitumor effect, but its mechanism in tumor metabolism, especially the Warburg effect has not been elucidated. Objectives: To study the molecular mechanism of berberine regulating the Warburg effect in ovarian cancer cells.
Suhas S Kharat et al.
Science signaling, 13(645) (2020-08-21)
Synthetic lethality between poly(ADP-ribose) polymerase (PARP) inhibition and BRCA deficiency is exploited to treat breast and ovarian tumors. However, resistance to PARP inhibitors (PARPis) is common. To identify potential resistance mechanisms, we performed a genome-wide RNAi screen in BRCA2-deficient mouse

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service