Skip to Content
Merck
All Photos(1)

Key Documents

EHU094851

Sigma-Aldrich

MISSION® esiRNA

targeting human APBB3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€193.00
50 μG
€342.00

€193.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€193.00
50 μG
€342.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€193.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAGTGCCATGTGTTTTGCTGTGATGTCCCTGCCAAGGCCATTGCCAGTGCCCTACATGGGCTTTGTGCCCAGATCTTGTCAGAGCGAGTAGAGGTCAGTGGTGATGCCTCTTGCTGCTCCCCAGACCCCATCTCTCCTGAAGACCTGCCACGGCAAGTGGAGCTGCTGGATGCGGTAAGCCAAGCTGCTCAGAAGTACGAGGCACTGTATATGGGGACACTGCCAGTCACCAAGGCCATGGGCATGGATGTGCTGAACGAGGCCATTGGTACCCTCACCGCCAGGGGGGACCGGAATGCCTGGGTCCCCACCATGCTCAGTGTGTCTGACTCTCTCATGACTGCACACCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Patompon Wongtrakoongate et al.
PLoS genetics, 11(10), e1005615-e1005615 (2015-10-27)
Long non-coding RNAs (lncRNAs) have been recognized as key players in transcriptional regulation. We show that the lncRNA steroid receptor RNA activator (SRA) participates in regulation through complex formation with trithorax group (TrxG) and polycomb repressive complex 2 (PRC2) complexes.

Questions

  1. What is the amount of 20 ug esiRNA in term mol?

    1 answer
    1. esiRNA is a pooled product with a variable molecular weight. The molecular weight can be estimated using the following information:
      - Calculation of esiRNA molar mass
      - A high percentage of the esiRNA pool is 21 bp
      - The average molar mass of one base including sugar and phosphate is 345 g/mol.
      - For an esiRNA (always double stranded) of 21 bp, the average molar mass can be calculated as follows: 2 x 21 x 345 = 14,490 g/mol

      For additional information please refer to the esiRNA technical bulletin in the link below:
      https://www.sigmaaldrich.com/deepweb/assets/sigmaaldrich/product/documents/786/318/cstesirnabul.pdf

      Helpful?

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service