Skip to Content
Merck
All Photos(1)

Key Documents

EHU088931

Sigma-Aldrich

MISSION® esiRNA

targeting human MSN

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€193.00
50 μG
€342.00

€193.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€193.00
50 μG
€342.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€193.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACCTGGCTGAAACTCAATAAGAAGGTGACTGCCCAGGATGTGCGGAAGGAAAGCCCCCTGCTCTTTAAGTTCCGTGCCAAGTTCTACCCTGAGGATGTGTCCGAGGAATTGATTCAGGACATCACTCAGCGCCTGTTCTTTCTGCAAGTGAAAGAGGGCATTCTCAATGATGATATTTACTGCCCGCCTGAGACCGCTGTGCTGCTGGCCTCGTATGCTGTCCAGTCTAAGTATGGCGACTTCAATAAGGAAGTGCATAAGTCTGGCTACCTGGCCGGAGACAAGTTGCTCCCGCAGAGAGTCCTGGAACAGCACAAACTCAACAAGGACCAGTGGGAGGAGCGGATCCAGGTGTGGCATGAGGAACACCGTGGCATGCTCAGGGAGGATGCTGTCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shubing Lan et al.
Biochemical and biophysical research communications, 524(4), 861-868 (2020-02-15)
Moesin has been proved to be implicated in invasiveness and metastasis in many other cancers, but unclear in HCC. Thus, this study was performed to investigate the clinical significance of moesin and its biological functions in HCC. The results showed
Bernard Degryse et al.
The international journal of biochemistry & cell biology, 88, 14-22 (2017-05-06)
The glycosyl-phosphatidyl-inositol (GPI)-anchored urokinase receptor (uPAR) has no intracellular domain, but nevertheless initiates signalling through proximal interactions with other membrane receptors including integrins. The relationships between uPAR and ezrin/radixin/moesin (ERM) proteins, moesin and merlin have never been explored. Moesin and
Yutaro Hoshi et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 40(7), 1533-1545 (2019-08-15)
The purpose of this study was to clarify the roles of ERM proteins (ezrin/radixin/moesin) in the regulation of membrane localization and transport activity of transporters at the human blood-brain barrier (BBB). Ezrin or moesin knockdown in a human in vitro BBB
Liza Botros et al.
Journal of cell science, 133(9) (2020-03-22)
Endothelial barrier dysfunction leads to edema and vascular leak, causing high morbidity and mortality. Previously, Abl kinase inhibition has been shown to protect against vascular leak. Using the distinct inhibitory profiles of clinically available Abl kinase inhibitors, we aimed to
Yao-yin Li et al.
Oral oncology, 51(10), 935-943 (2015-07-22)
The present study aimed to clarify the role of Moesin in oral squamous cell carcinoma (OSCC) progression, especially in regulation of cell motility. Immunohistochemistry and western blotting were used to investigate the expression of Moesin, E-cadherin, p120-catenin and MT1-MMP in

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service