Skip to Content
Merck
All Photos(1)

Documents

EHU083931

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB16

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACCCCTACGAGTGTGAGTTCTGTGGCAGCTGCTTCCGGGATGAGAGCACACTCAAGAGCCACAAACGCATCCACACGGGTGAGAAACCCTACGAGTGCAATGGCTGTGGCAAGAAGTTCAGCCTCAAGCATCAGCTGGAGACGCACTATAGGGTGCACACAGGTGAGAAGCCCTTTGAGTGTAAGCTCTGCCACCAGCGCTCCCGGGACTACTCGGCCATGATCAAGCACCTGAGAACGCACAACGGCGCCTCGCCCTACCAGTGCACCATCTGCACAGAGTACTGCCCCAGCCTCTCCTCCATGCAGAAGCACATGAAGGGCCACAAGCCCGAGGAGATCCCGCCCGACTGGAGGATAGAGAAGACGTACCTCTACCTGTGCTATGTGTGAAGGGAGGC

Ensembl | human accession no.

ENSG00000109906

NCBI accession no.

NM_006006

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ZBTB16(7704) , ZBTB16(7704)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wencong Song et al.
Journal of cellular biochemistry, 116(10), 2155-2165 (2015-03-27)
The balance between the self-renewal and differentiation of male germline stem cells (mGSCs) is critical for the initiation and maintenance of mammalian spermatogenesis. The promyelocytic leukemia zinc finger (PLZF), a zinc finger protein, is a critical factor for maintaining the
Wencheng Kong et al.
Aging, 12(23), 24009-24022 (2020-11-23)
Peritoneal metastasis (PM) is the main cause of poor prognosis in patients with advanced gastric cancer (GC). Increasing evidence has suggested that cancer-associated EVs in body fluids may assist in the diagnosis and treatment of GC. Here, we investigated the
Yung-Ho Hsu et al.
PloS one, 7(1), e30674-e30674 (2012-02-01)
Many studies suggest that far-infrared (FIR) therapy can reduce the frequency of some vascular-related diseases. The non-thermal effect of FIR was recently found to play a role in the long-term protective effect on vascular function, but its molecular mechanism is
Julien M D Legrand et al.
Nature communications, 10(1), 2278-2278 (2019-05-28)
Mammalian spermatogenesis is sustained by mitotic germ cells with self-renewal potential known as undifferentiated spermatogonia. Maintenance of undifferentiated spermatogonia and spermatogenesis is dependent on tightly co-ordinated transcriptional and post-transcriptional mechanisms. The RNA helicase DDX5 is expressed by spermatogonia but roles

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service