Skip to Content
Merck
All Photos(1)

Key Documents

EHU068841

Sigma-Aldrich

MISSION® esiRNA

targeting human AMFR

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€193.00
50 μG
€342.00

€193.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€193.00
50 μG
€342.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€193.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCTTTCTGTCCCACTACATCTGGGACTGACTTTCCGAGCCTCCAGTCCAAAGCCGGCTTGATTTCCGTGAACTCTGGTGCTCCTGCATCTCATGAGTGTGCCCCATGGGTCCCCTCCCCTCTCAGCATTTCCTTGTCCCGTCTGGACCTGGGGAGTGGTTAGGCAGCAAGCTTTGGTTTATGGTTTTCATTCATTGGTGAAGTAAATTAGGCAGTGCTAAAGCCTGTGGGTTTGGTCCTTGAACAAGATGTGGGCCTTGCAAGATGGGAGAGTAAACCTTGAAGGGCTTTATTAAAGAAATAAAAAAGAACTTTTGTATCTTTTATCCTGGGAGCACTGCGTTTTCCTAGCTGTGTTATTCCTGGTTTAATTCAGCAGAGAAGGTAAGGTGTGAACCTACCTGCCTTGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Youngah Jo et al.
Molecular biology of the cell, 24(3), 169-183 (2012-12-12)
Sterol-induced binding to Insigs in endoplasmic reticulum (ER) membranes triggers ubiquitination of the cholesterol biosynthetic enzyme 3-hydroxy-3-methylglutaryl CoA reductase. This ubiquitination, which is mediated by Insig-associated ubiquitin ligases gp78 and Trc8, is obligatory for extraction of reductase from lipid droplet-associated
Jin Chai et al.
Journal of hepatology, 63(6), 1440-1448 (2015-07-28)
Multidrug resistance-associated protein 2 (MRP2) excretes conjugated organic anions including bilirubin and bile acids. Malfunction of MRP2 leads to jaundice in patients. Studies in rodents indicate that Radixin plays a critical role in determining Mrp2 canalicular membrane expression. However, it
Ming Zong et al.
Arthritis research & therapy, 17, 100-100 (2015-04-19)
Fibroblast-like synoviocytes (FLS) play an important role in the pathogenesis of rheumatoid arthritis (RA). This study aimed to investigate the role of glucose 6-phosphate isomerase (GPI) in the proliferation of RA-FLS. The distribution of GPI in synovial tissues from RA
Kerrie L Marie et al.
Nature communications, 11(1), 333-333 (2020-01-18)
Cutaneous malignant melanoma is an aggressive cancer of melanocytes with a strong propensity to metastasize. We posit that melanoma cells acquire metastatic capability by adopting an embryonic-like phenotype, and that a lineage approach would uncover metastatic melanoma biology. Using a

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service