Skip to Content
Merck
All Photos(1)

Documents

EHU157051

Sigma-Aldrich

MISSION® esiRNA

targeting human MCM10

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCAAGCTGCTGGAGACCTGCGTCAGTGAGCAGCATGAATACCACTGGCATGATGGTGTGAAGAGGTTTTTCAAATGTCCCTGTGGAAACAGAAGCATCTCCTTGGACAGACTCCCGAACAAGCACTGCAGTAACTGTGGCCTCTACAAATGGGAACGGGACGGAATGCTAAAGGAAAAGACTGGTCCAAAGATAGGAGGAGAAACTCTGTTACCAAGAGGAGAAGAACATGCTAAATTTCTGAACAGCCTTAAATAACCCGAACTTCAGACATTTTCCCACAGACTTCCTGGCCTCCTGTGACTCTGGAAAGCAAAGGATTGGCTGTGTATTGTCCATTGATTCCTGATTGACGCCGTCAAAAACAAATGCTTGTTAAGCCCATAAGCTTTGCCTGCTTACTTTCTGCCATTGGG

Ensembl | human accession no.

ENSG00000065328

NCBI accession no.

NM_182751

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MCM10(55388) , MCM10(55388)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feilun Cui et al.
The Prostate, 78(16), 1299-1310 (2018-08-11)
Prostate cancer (PCa) is one of the most malignant tumors of the male urogenital system. There is an urgent need to identify novel biomarkers for PCa. In this study, we evaluated the expression levels of MCM10 in prostate cancer by
Wei-Dong Yang et al.
Journal of biochemical and molecular toxicology, 33(7), e22330-e22330 (2019-04-17)
The minichromosome maintenance protein 10 (MCM10) is one of the MCM proteins that initiate DNA replication by interacting with CDC45-MCM2-7. It has been reported that MCM10 has a role in breast cancer progression. However, MCM10 in breast cancer is still not comprehensively
Peng Kang et al.
Journal of molecular neuroscience : MN, 70(5), 759-768 (2020-02-08)
Minichromosome maintenance 10 (MCM10) plays an important role in DNA replication and is expressed in a variety of tumors, including glioma. However, its role and mechanism in glioma remain elusive. The purpose of this study was to examine the molecular
Bizhan Romani et al.
The Journal of biological chemistry, 290(28), 17380-17389 (2015-06-03)
Human immunodeficiency virus type 1 Vpr is an accessory protein that induces G2/M cell cycle arrest. It is well documented that interaction of Vpr with the Cul4-DDB1[VprBP] E3 ubiquitin ligase is essential for the induction of G2/M arrest. In this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service