Skip to Content
Merck
All Photos(1)

Key Documents

EHU066891

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC39A8

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCCCAAACTGTCAGAAATAGGGACGATTGCCTGGATGATAACGCTCTGCGATGCCCTCCACAATTTCATCGATGGCCTGGCGATTGGGGCTTCCTGCACCTTGTCTCTCCTTCAGGGACTCAGTACTTCCATAGCAATCCTATGTGAGGAGTTTCCCCACGAGTTAGGAGACTTTGTGATCCTACTCAATGCAGGGATGAGCACTCGACAAGCCTTGCTATTCAACTTCCTTTCTGCATGTTCCTGCTATGTTGGGCTAGCTTTTGGCATTTTGGTGGGCAACAATTTCGCTCCAAATATTATATTTGCACTTGCTGGAGGCATGTTCCTCTATATTTCTCTGGCAGATATGTTTCCAGAGATGAATGATATGCTGAGAGAAAAGGTAACTGGAAGAAAAACCGATTTCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ken Kijima et al.
EBioMedicine, 41, 659-669 (2019-03-25)
Spinal cord injury (SCI) is a devastating disorder for which the accurate prediction of the functional prognosis is urgently needed. Due to the lack of reliable prediction methods, the acute evaluation of SCI severity and therapeutic intervention efficacy is extremely
Richard Coffey et al.
American journal of physiology. Cell physiology, 312(2), C169-C175 (2016-12-03)
The relationship between iron and β-cell dysfunction has long been recognized as individuals with iron overload display an increased incidence of diabetes. This link is usually attributed to the accumulation of excess iron in β-cells leading to cellular damage and
Brittany L Steimle et al.
The Journal of biological chemistry, 294(50), 19197-19208 (2019-11-09)
Manganese supports numerous neuronal functions but in excess is neurotoxic. Consequently, regulation of manganese flux at the blood-brain barrier (BBB) is critical to brain homeostasis. However, the molecular pathways supporting the transcellular trafficking of divalent manganese ions within the microvascular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service