Skip to Content
Merck
All Photos(1)

Key Documents

EHU032411

Sigma-Aldrich

MISSION® esiRNA

targeting human STAM

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACATGAAGGCCGAAAAGTTCGTGCTATATATGACTTTGAAGCTGCTGAAGACAATGAACTTACTTTTAAAGCTGGAGAAATTATTACAGTTCTTGATGACAGTGATCCTAACTGGTGGAAAGGTGAAACCCATCAAGGCATAGGGTTATTTCCTTCTAATTTTGTGACTGCAGATCTCACTGCTGAACCAGAAATGATTAAAACAGAGAAGAAGACGGTACAATTTAGTGATGATGTTCAGGTAGAGACAATAGAACCAGAGCCGGAACCAGCCTTTATTGATGAAGATAAAATGGACCAGTTGCTACAGATGCTGCAAAGTACAGACCCCAGTGATGATCAGCCAGACCTACCAGAGCTGCTTCATCTTGAAGCAATGTGTCACCAGATGGGACCTCTCATTGATGAAAAGCTGGAAGATATTGATAGAAAACATTCAGAACTCTCAGAACTTAATGTGAAAGTGATGGAGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rutuja Kulkarni et al.
Scientific reports, 7(1), 14787-14787 (2017-11-03)
Exosomes are membrane enclosed nano-sized vesicles actively released into the extracellular milieu that can harbor genomic, proteomic and lipid cargos. Functionally, they are shown to regulate cell-cell communication and transmission of pathogens. Though studies have implicated a role for exosomes
Olga Alekhina et al.
The Journal of biological chemistry, 291(50), 26083-26097 (2016-10-30)
The chemokine receptor CXCR4 and its chemokine ligand CXCL12 mediate directed cell migration during organogenesis, immune responses, and metastatic disease. However, the mechanisms governing CXCL12/CXCR4-dependent chemotaxis remain poorly understood. Here, we show that the β-arrestin1·signal-transducing adaptor molecule 1 (STAM1) complex

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service