Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU062931

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vegfa

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCACGACAGAAGGAGAGCAGAAGTCCCATGAAGTGATCAAGTTCATGGATGTCTACCAGCGAAGCTACTGCCGTCCGATTGAGACCCTGGTGGACATCTTCCAGGAGTACCCCGACGAGATAGAGTACATCTTCAAGCCGTCCTGTGTGCCGCTGATGCGCTGTGCAGGCTGCTGTAACGATGAAGCCCTGGAGTGCGTGCCCACGTCAGAGAGCAACATCACCATGCAGATCATGCGGATCAAACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAGCAGATGTGAATGCAGACCAAAGAAAGACAGAACAAAGCCAGAAAATCACTGTGAGCCTTGTTCAGAGCGGAGAAAGCATT

Ensembl | mouse accession no.

ENSMUSG00000023951

NCBI accession no.

NM_001025257

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... VEGFA(22339) , Vegfa(22339)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
VIU
KXR
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xue-jun Shao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(5), 2051-2062 (2015-07-24)
Down-expression of microRNA-497 (miR-497) was often found in malignancies. The purposes of this study were to determine the expression of miR-497 in human osteosarcoma and to establish the association between miR-497 expression with cell survival and the sensitivity to cisplatin
Yang Ding et al.
Biomaterials, 35(25), 7214-7227 (2014-05-31)
We described here the mechanisms by which small interfering RNA (siRNA) molecules incorporated in reconstituted high density lipoprotein (rHDL) were efficiently transferred into the cytoplasm of cells to perform target-specific therapy of tumor angiogenesis. Using fluorescent-tagged apolipoprotein A-I (apoA-I) and
Zhili Wen et al.
PloS one, 9(9), e104666-e104666 (2014-09-25)
MicroRNAs have been appreciated in various cellular functions, including the regulation of angiogenesis. Mesenchymal-stem-cells (MSCs) transplanted to the MI heart improve cardiac function through paracrine-mediated angiogenesis. However, whether microRNAs regulate MSC induced angiogenesis remains to be clarified. Using microRNA microarray
Yinan Wang et al.
PloS one, 10(6), e0130341-e0130341 (2015-06-16)
The transcription factor Krüppel-like factor 4 (KLF4) has been implicated in regulating cell proliferation, migration and differentiation in a variety of human cells and is one of four factors required for the induction of pluripotent stem cell reprogramming. However, its
Tingting Li et al.
International journal of nanomedicine, 10, 4279-4291 (2015-07-15)
Engineering a safe and high-efficiency delivery system for efficient RNA interference is critical for successful gene therapy. In this study, we designed a novel nanocarrier system of polyethyleneimine (PEI)-modified Fe3O4@SiO2, which allows high efficient loading of VEGF small hairpin (sh)RNA
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico