Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU101391

Sigma-Aldrich

MISSION® esiRNA

targeting human OPA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGGGGAGATGATGACACGTTCTCCAGTTAAGGTGACTCTGAGTGAAGGTCCTCACCATGTGGCCCTATTTAAAGATAGTTCTCGGGAGTTTGATCTTACCAAAGAAGAAGATCTTGCAGCATTAAGACATGAAATAGAACTTCGAATGAGGAAAAATGTGAAAGAAGGCTGTACCG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lucie Potuckova et al.
Frontiers in immunology, 9, 1771-1771 (2018-08-18)
C-terminal Src kinase (CSK) is a major negative regulator of Src family tyrosine kinases (SFKs) that play critical roles in immunoreceptor signaling. CSK is brought in contiguity to the plasma membrane-bound SFKs via binding to transmembrane adaptor PAG, also known
Kamariah Ibrahim et al.
International journal of molecular medicine, 46(2), 685-699 (2020-05-30)
Glioblastoma multiforme (GBM) is an aggressive type of brain tumour that commonly exhibits resistance to treatment. The tumour is highly heterogenous and complex kinomic alterations have been reported leading to dysregulation of signalling pathways. The present study aimed to investigate

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico