Skip to Content
Merck
All Photos(2)

Key Documents

EHU051011

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK1

Sign Into View Organizational & Contract Pricing
All Photos(2)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCT

Ensembl | human accession no.

ENSG00000166851

NCBI accession no.

NM_005030

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PLK1(5347) , PLK1(5347)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinhua Dong et al.
Biotechnology and bioengineering, 117(5), 1259-1269 (2020-02-11)
Ultra Quenchbody (UQ-body) is a biosensor that utilizes the quenching behavior of the fluorescent dye linked to the antibody V region. When the corresponding antigen is bound to the UQ-body, the fluorescence is restored and allows the detection of target
Hui Shi et al.
International journal of nanomedicine, 15, 3347-3362 (2020-06-05)
Temozolomide (TMZ) is the first-line chemotherapeutic option to treat glioma; however, its efficacy and clinical application are limited by its drug resistance properties. Polo-like kinase 1 (PLK1)-targeted therapy causes G2/M arrest and increases the sensitivity of glioma to TMZ. Therefore
Tomonori Higuchi et al.
Scientific reports, 7(1), 11026-11026 (2017-09-10)
The genetic events that lead to aggressive transformation of cases of splenic marginal zone lymphoma (SMZL) after the chronic clinical stage have not been well understood. We aimed to find candidate genes associated with aggressive features of SMZL. We have
Xiao Peng Cai et al.
American journal of translational research, 8(10), 4172-4183 (2016-11-11)
Cancer cell epithelial-mesenchymal transition (EMT) is the crucial event for cancer progression and plays a vital role in the metastasis of cancer cells. Activation of Polo-like kinase 1 (PLK1) signaling has been implicated as the critical event in several tumor
Dongzhi Wang et al.
Anti-cancer agents in medicinal chemistry, 17(7), 948-954 (2016-09-28)
Recent investigations have implicated that Chitosan-nucleotide nanoparticles might be useful non-viral carriers in gene therapy. Polo-like kinase 1 (PLK1) has been reported to be an important oncogene that exerted considerable therapeutic merit in hepatocellular carcinoma (HCC). We explored whether Galactosylated
View All Related Papers

Articles

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service