Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHURLUC

Sigma-Aldrich

MISSION® esiRNA

targeting RLUC

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Conditions d'expédition

ambient

Température de stockage

−20°C

Description générale

EHURLUC targets Renilla Luciferase. It can be used as a negative control in systems lacking Renilla Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Autres remarques

esiRNA cDNA target sequence: GATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGG

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rachel Elizabeth Miller et al.
Biochemical and biophysical research communications, 500(2), 391-397 (2018-04-15)
PPM1B is a metal-dependent serine/threonine protein phosphatase, with a similar structure and function to the well-known oncogene in breast cancer, PPM1D (WIP1). However, clinical significance of PPM1B as a pharmacological target in cancer therapy has not been explored. To test
6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Laura R Hardy et al.
Oncogene, 38(32), 6003-6016 (2019-07-13)
High grade serous ovarian cancer (HGSOC) is the fifth leading cause of cancer deaths among women yet effective targeted therapies against this disease are limited. The heterogeneity of HGSOC, including few shared oncogenic drivers and origination from both the fallopian
Jonasz J Weber et al.
Human molecular genetics, 29(6), 892-906 (2020-01-22)
Proteolytic fragmentation of polyglutamine-expanded ataxin-3 is a concomitant and modifier of the molecular pathogenesis of Machado-Joseph disease (MJD), the most common autosomal dominant cerebellar ataxia. Calpains, a group of calcium-dependent cysteine proteases, are important mediators of ataxin-3 cleavage and implicated
Jonasz Jeremiasz Weber et al.
Neuropharmacology, 133, 94-106 (2018-01-23)
Deciphering the molecular pathology of Huntington disease is of particular importance, not only for a better understanding of this neurodegenerative disease, but also to identify potential therapeutic targets. The polyglutamine-expanded disease protein huntingtin was shown to undergo proteolysis, which results
Afficher tous les articles scientifiques apparentés

Articles

esiRNA FAQs (Frequently Asked Questions)

esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.

esiRNA FAQs (Frequently Asked Questions)

esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.

esiRNA FAQs (Frequently Asked Questions)

esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.

esiRNA FAQs (Frequently Asked Questions)

esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique