Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU116331

Sigma-Aldrich

MISSION® esiRNA

targeting human ENO1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATATGGGAAAGATGCCACCAATGTGGGGGATGAAGGCGGGTTTGCTCCCAACATCCTGGAGAATAAAGAAGGCCTGGAGCTGCTGAAGACTGCTATTGGGAAAGCTGGCTACACTGATAAGGTGGTCATCGGCATGGACGTAGCGGCCTCCGAGTTCTTCAGGTCTGGGAAGTATGACCTGGACTTCAAGTCTCCCGATGACCCCAGCAGGTACATCTCGCCTGACCAGCTGGCTGACCTGTACAAGTCCTTCATCAAGGACTACCCAGTGGTGTCTATCGAAGATCCCTTTGACCAGGATGACTGGGGAGCTTGGCAGAAGTTCACAGCCAGTGCAGGAATCCAGGTAGTGGGGGATGATCTCACAGTGACCAACCCAAAGAGGATCGCCAAGGCCGTGAACGAGAAGTCCTGCAACTGCCT

Numéro d'accès Ensembl | humain

ENSG00000074800

Numéro d'accès NCBI

NM_001428

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ENO1(2023) , ENO1(128178)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaoling Qian et al.
Oncotarget, 8(29), 47691-47708 (2017-05-27)
Chemotherapy is the major choice for the cancer treatment of early and advanced stages. However, intrinsic or acquired drug resistance significantly restricts the clinical efficacy of chemotherapy. It is critical to develop novel approaches to detect and overcome drug resistance.
Hui Qiao et al.
Journal of cellular biochemistry, 120(11), 18714-18723 (2019-06-21)
Gastric cancer has become the third most common cancer around the world. In patients with gastric cancer, the 5-year survival rate is still low. However, the mechanism underlying gastric cancer remains largely unknown. As a glycolytic enzyme, enolase 1 (ENO1)
Naoki Kishimoto et al.
Retrovirology, 17(1), 31-31 (2020-09-13)
A protein exhibiting more than one biochemical function is termed a moonlighting protein. Glycolytic enzymes are typical moonlighting proteins, and these enzymes control the infection of various viruses. Previously, we reported that glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and alpha-enolase (ENO1) are
Yasmarie Santana-Rivera et al.
American journal of translational research, 12(4), 1275-1292 (2020-05-02)
Despite good responses to first-line treatment with platinum-based combination chemotherapy, most ovarian cancer patients will relapse and eventually develop a platinum-resistant disease with a poor overall prognosis. The molecular events leading to the cisplatin resistance of ovarian cancer cells are

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique