Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU081481

Sigma-Aldrich

MISSION® esiRNA

targeting human MITF

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGGGGTTTATTTCAGCAAACTTGTTGAATTTATTTTTAAGAAAGAAATACTGTATTGGGAAGTTACTGTTACTTGATAACAATGTTTTAACAAGAAGCAATGTTATAAAGTTAGTTTCAGTGCATTATCTACTTGTGTAGTCCTATGCAATAACAGTAGTGTTACATGTATCAAGCCTAGATGTTTTATACAGATGCCATATAGTGTTATGAGCCAGGCTGTTGAATGGAATTTCTCAGTAGCAGCCTACAACTGAATAGCAAGTGGCATAAAGCATATCCATTCAGAATGAAGTGCCTTAAATATAGCAGTAGTCTTTTTTGGACTAGCACTGACTGAACTGTAATGTAGGGGAAAGTTTCATGATGGTATCTATAGTCAAGACGAACATGTAGCATGGTGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jing Wang et al.
Journal of cellular biochemistry, 119(11), 8862-8871 (2018-08-21)
Oral lichen planus (OLP) is a severe T cell-mediated disorder of the mucosa, which causes chronic inflammation. Forkhead box P3 (Foxp3) regulates the immune response and plays an important role in immunological diseases. The current study aimed to determine the
Jijun Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 581-593 (2017-11-18)
Increasing evidence indicates that Huaier extract has promising therapeutic effects against cancer. However, the mechanisms that underlie its anti-tumor effects remain unclear. In recent years, various studies have shown that long noncoding RNAs (lncRNAs) play a critical role in the
Paola Falletta et al.
Genes & development, 31(1), 18-33 (2017-01-18)
The intratumor microenvironment generates phenotypically distinct but interconvertible malignant cell subpopulations that fuel metastatic spread and therapeutic resistance. Whether different microenvironmental cues impose invasive or therapy-resistant phenotypes via a common mechanism is unknown. In melanoma, low expression of the lineage
Yue Chang et al.
Cancer cell international, 21(1), 29-29 (2021-01-09)
Endometrial cancer is an invasive gynecological cancer prevalent in the world. The pathogenesis of endometrial cancer is related to multiple levels of regulation, referring to oestrogen, tumor-suppressor gene (e.g. PTEN) or microRNAs (e.g. miR-23a and miR-29b). Metapristone is a hormone-related
Megha Rajasekhar et al.
Scientific reports, 8(1), 7264-7264 (2018-05-10)
Myelopoiesis involves differentiation of hematopoietic stem cells to cellular populations that are restricted in their self-renewal capacity, beginning with the common myeloid progenitor (CMP) and leading to mature cells including monocytes and granulocytes. This complex process is regulated by various

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique