Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU009371

Sigma-Aldrich

MISSION® esiRNA

targeting human CENPJ

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTCGAAGATCCAAGTCTGCACCTCCTCGTGATTTAGGCAATTTGGATAAGGGACAAGCTGCCTCTCCCAGGGAGCCACTTGAACCACTGAACTTCCCAGATCCTGAATATAAAGAGGAGGAGGAAGACCAAGACATACAGGGAGAAATCAGTCATCCTGATGGAAAGGTGGAAAAGGTTTATAAGAATGGGTGCCGTGTTATACTGTTTCCCAATGGAACTCGAAAGGAAGTGAGTGCAGATGGGAAGACCATCACTGTCACTTTCTTTAATGGTGACGTGAAGCAGGTCATGCCAGACCAAAGAGTGATCTACTACTATGCAGCTGCCCAGACCACTCACACGACATACCCGGAGGGACTGGAAGTCTTACATTTCTCAAGTGGACAAATAGAAAAACATTACCCAGATGGAAGAAAAGAAATCACGTTTCCTGACCAGACTGTTAAAAACTTATTTCCTGATGGACAAGAAGAAAGCATTTTCCCAGATGGTACAATTGTCAGAGTACAACGTGATGGCAACAAACT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tao Xu et al.
Toxicology letters, 294, 177-183 (2018-05-21)
Alcohol can decrease cell proliferation in neural cells. The proliferation of neural cells can be inhibited by the asymmetric division of neural progenitor cells. However, whether alcohol inhibits cell proliferation through inducing cell asymmetric division is not yet clear. Here
Fernando R Balestra et al.
eLife, 10 (2021-01-26)
TRIM37 is an E3 ubiquitin ligase mutated in Mulibrey nanism, a disease with impaired organ growth and increased tumor formation. TRIM37 depletion from tissue culture cells results in supernumerary foci bearing the centriolar protein Centrin. Here, we characterize these centriolar
Patricia P Garcez et al.
Nature communications, 6, 6474-6474 (2015-03-11)
The proneural factor Ascl1 controls multiple steps of neurogenesis in the embryonic brain, including progenitor division and neuronal migration. Here we show that Cenpj, also known as CPAP, a microcephaly gene, is a transcriptional target of Ascl1 in the embryonic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique