Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
shipped in
ambient
storage temp.
−20°C
Related Categories
General description
EHUFLUC targets Firefly Luciferase. It can be used as a negative control in systems lacking Firefly Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Other Notes
esiRNA cDNA target sequence: GAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATT
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
WGK
WGK 1
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Certificates of Analysis (COA)
Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Customers Also Viewed
Scientific reports, 8(1), 15757-15757 (2018-10-27)
Adipose tissue dysfunction is considered an important contributor to systemic insulin resistance and Type 2 diabetes (T2D). Recently, a novel family of endogenous lipids, palmitic acid hydroxy stearic acids (PAHSAs), was discovered. These have anti-diabetic and anti-inflammatory effects in mice
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
PloS one, 14(5), e0213116-e0213116 (2019-05-22)
The mitochondrial outer membrane protein Mitochondrial Fission Factor (Mff) plays a key role in both physiological and pathological fission. It is well established that at stressed or functionally impaired mitochondria, PINK1 recruits the ubiquitin ligase Parkin which ubiquitinates Mff and
Biochimica et biophysica acta. Molecular basis of disease, 1864(9 Pt B), 2793-2813 (2018-05-20)
Many biological processes result from the coupling of metabolic pathways. Considering this, proliferation depends on adequate iron and polyamines, and although iron-depletion impairs proliferation, the metabolic link between iron and polyamine metabolism has never been thoroughly investigated. This is important
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 35(12), 2423-2431 (2020-08-12)
A role for long non-coding RNAs (lncRNAs) in endocrine cancer pathogenesis is emerging. However, knowledge regarding their expression pattern, correlation with known genetic defects, and clinical implications in parathyroid tumors is still unclear. Here, we profiled 90 known lncRNAs in
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service