Skip to Content
Merck

RAB0325

Sigma-Aldrich

Inhibin-B EIA Kit

for serum, plasma, culture supernatant and cell lysates

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Availability

Estimated to ship on07 March 2025


To order products, please contact your local dealer.

Select a Size

Change View
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

UNSPSC Code:
41123300
NACRES:
NA.32

MXP 5,935.00


Availability

Estimated to ship on07 March 2025


To order products, please contact your local dealer.

species reactivity

rat, mouse, human

packaging

kit of 96 wells (12 strips x 8 wells)

technique(s)

ELISA: suitable
enzyme immunoassay: suitable

input

sample type plasma
sample type cell lysate
sample type serum
sample type culture supernatant(s)

assay range

inter-assay cv: <15%
intra-assay cv: <10%
sensitivity: 2 pg/mL
standard curve range: 1-10000 pg/mL

detection method

colorimetric

shipped in

wet ice

storage temp.

−20°C

Gene Information

human ... INHBB(3625)

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU017811EMU020781EMU021451
product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Gene Information

mouse ... TMEM140(68487), Tmem140(68487)

Gene Information

mouse ... TMEM14C(66154), Tmem14c(66154)

Gene Information

mouse ... TMEM150(232086), Tmem150(232086)

Gene Information

mouse ... TMEM110(69179), Tmem110(69179)

esiRNA cDNA target sequence

TGCCTAGCCCAGCTGTTACTCATCTTCTTGCTTGTGGCCACGGTTAGGTTCCCGCCACGGGATAAGGAGGACAAGAACCAGTGGGAGAACTGTTAGTCCGGTCTTACAAAGGCTTATTATGGGATTGCAAGGGTTCGGTTCCAACTGTGCTCCAAGAAGGTGCCAGAGGACCTGTGCTGAGTAGTTCTTCTCAGTCACCCTGTGTCATAGCTAATGTTGATCTCCAGCACAGCAGAGGGGACCACTCACTGTGCAGACGGGCTGTGGTGTCAAGGAACCCAGAGGCGGCTTGGAGGGCTGGGGTACCTGCAGTTTCTTAGGGTACCATGTAGCTCATTAGCACAGGGATTCCTATAGTCCCAGGCAGGTGGGAGTCTGTCAGAGGCCAAACTTCCAAGCTATCTTGGCAAAGTGTCAAACTAGAACTCTGTGATGGTTATGGCAACAAATGGGATGATTAGGGGAAAAACAAAAAACAAACAAACAAGCAACCTGCTTTAACACCGAGTCCTGTCAGCACAAAGAGAAGCCTCACTGGC

esiRNA cDNA target sequence

CTGTCTCAGGATCCCAGGAATGTGTGGGTTTTCCTAGCTACATCTGGGACCTTGGCCGGAATTATGGGGATGAGATTCTACAACTCGGGGAAATTTATGCCTGCAGGGTTAATCGCAGGAGCCAGTTTGCTGATGGTTGCCAAAGTTGGAATTAGTCTGTTGAGTTCACCTCATCCGTAACAGCTGTAACCCCGAGTGGGCTCGTGAAGACTTGAAGCTCTCCAGACCTCCACATTACAATGTTGAAGAGATAAGTGCAGCATATTTACATAGTGGGACGTTTTTTCAAAGACCCACCCTGAGCACACTGAGGCAACCATGTGCTGTTGCTGTGGTGACCATTCATTCAGAGGTGGCAAGCGTCCGACTTCAGCTCACGCTGCCTTCAGGCGGCTTCGTTATGATGCCTCGCCTTTCTGTACTCATAGCGGGGG

esiRNA cDNA target sequence

GCAACATGGGTGCTGTTATGGTGGCCCTCATCTGCCTCCTTCGGTACGGGCAGCTCCTGGAACAGAGCCGGCACTCCTGGATCAATACCACTGCACTCATCACTGGTTGCACCAACGCTGCAGGCCTCGTGGTGGTCGGCAATTTTCAGGTGGACCATGCCAAGTCTCTACACTACATCGGAACTGGTGTGGCCTTCACTGCTGGGCTGCTCTTTGTGTGCCTGCACTGTGTTCTCTTCTACCATGGGGCCACCACCCCCCTGGACATGGCTATGGCCTACCTTCGAAGTGTGCTGGCTGTCATCGCCTTCATCACCCTGGTCCTTAGTGGAGTCTTCTTCCTCCACGAGAGTTCTCAGCTCCAGCATGGAGCTGCTCTGTGTGAATGGGTGTTTGTCCTCGATATCCTCATTTTCTATGGCACCTTCAGCTATGAGTTCGGG

esiRNA cDNA target sequence

AGCCATAGGGATGCTCTTCATCCACTTTGCAAATGTGTACCTAGCAGATCTCACTGAAGAGGACCCTTGTTCACTGTACCTCATCAACTTTCTTCTGGACGCCACTGTAGGCATGCTGCTCATTTATGTGGGCGTACGCGCCGCCGGTGTCTTGGTGGAGTGGCAGCAGTGGGAATCCCTGCGTTTGGGAGAATATGGAGACCCTCTGCAGTGCGGGGCCTGGGTAGGACAGTGCGCCCTCTACATGGTGATCATGATCTTTGAAAAGTCCGTGGTCTTCATCGTCCTCCTCATACTCCAGTGGAAAAAGGTGGCCCTATTGAATCCAATTGAAAACCCCGACCTGAAGCTGGCCATCGTCATGCTGATAGTCCCCTTCTTTGTCAATGCTTTCATGTTCTGGGTAGTGGACAATTTCCTCATGAGAAAGGGGAAGACGAAAGC

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

Inhibin-B (INHBB) is a heterodimeric glycoprotein with disulfide-linkage. It is produced by granulosa cells in the ovary.[1] The INHBB gene is mapped to human chromosome 2q14.2.[2] Inhibin-B inhibits follicle-stimulating hormone (FSH) secretion and synthesis.[1] It may serve in diagnosing testicular function[3] and as an indicator of Sertoli cell numbers and function.[4] Inhibin B may serve as a marker for spermatogenesis.[5]
The Inhibin B Enzyme Immunoassay (EIA) Kit is an in vitro quantitative assay for detecting Inhibin B peptide based on the principle of Competitive Enzyme Immunoassay. EIA-INB-1 targets the β B subunit, and therefore theoretically detects Activin B and Activin AB in addition to Inhibin B.
The Inhibin B Enzyme Immunoassay (EIA) Kit is an in vitro quantitative assay for detecting Inhibin B peptide based on the principle of Competitive Enzyme Immunoassay. EIA-INB-1 targets the β B subunit, and therefore theoretically detects Activin B and Activin AB in addition to Inhibin B.

Immunogen

Inhibin-B, synthetic peptide

Application

Inhibin-B EIA Kit has been used in quantification of Inhibin-B using enzyme-linked immunosorbent assay (ELISA) in Zika virus-infected human Sertoli cells (HSerC)[5] and 8-week-old mice.[4]

Kit Components Also Available Separately

Product No.
Description
SDS

Pictograms

Corrosion

Signal Word

Warning

Hazard Statements

Precautionary Statements

Hazard Classifications

Met. Corr. 1

Storage Class Code

8A - Combustible corrosive hazardous materials


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S J Meachem et al.
European journal of endocrinology, 145(5), 561-571 (2001-11-27)
The recent availability of specific inhibin assays has demonstrated that inhibin B is the relevant circulating inhibin form in the human male. Inhibin B is a dimer of an alpha and a betaB subunit. It is produced exclusively by the
Mahamud-Ur Rashid et al.
PLoS neglected tropical diseases, 14(6), e0008335-e0008335 (2020-06-09)
Zika virus (ZIKV), a neglected tropical disease until its re-emergence in 2007, causes microcephaly in infants and Guillain-Barré syndrome in adults. Its re-emergence and spread to more than 80 countries led the World Health Organization in 2016 to declare a
M Chada et al.
Physiological research, 52(3), 341-346 (2003-06-07)
Inhibin B, produced by granulosa cells in the ovary, is a heterodimeric glycoprotein suppressing synthesis and secretion of the follicle stimulating hormone (FSH). The aim of the present study was to determine hormone profiles of inhibin B, FSH, luteinizing hormone
R Mayor et al.
British journal of cancer, 100(10), 1534-1539 (2009-04-23)
Large chromosomal regions can be suppressed in cancer cells as denoted by hypermethylation of neighbouring CpG islands and downregulation of most genes within the region. We have analysed the extent and prevalence of long-range epigenetic silencing at 2q14.2 (the first
Liang-Yu Chen et al.
Proceedings of the National Academy of Sciences of the United States of America, 113(7), 1829-1834 (2016-02-03)
Spermatogonial stem cells (SSCs) are a subpopulation of undifferentiated spermatogonia located in a niche at the base of the seminiferous epithelium delimited by Sertoli cells and peritubular myoid (PM) cells. SSCs self-renew or differentiate into spermatogonia that proliferate to give

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service