Skip to Content
Merck
All Photos(1)

Key Documents

EHU013491

Sigma-Aldrich

MISSION® esiRNA

targeting human HSF2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCCAAGGGAGAGGATTTCAGATGACATCATTATTTATGATGTTACTGATGATAATGCAGATGAAGAAAATATCCCAGTTATTCCAGAAACTAATGAGGATGTTATATCTGATCCCTCCAACTGTAGCCAGTACCCTGATATTGTCATCGTTGAAGATGACAATGAAGATGAGTATGCACCTGTCATTCAGAGTGGAGAGCAGAATGAACCAGCCAGAGAATCCCTAAGTTCAGGCAGTGATGGCAGCAGCCCTCTCATGTCTAGTGCTGTCCAGCTAAATGGCTCATCCAGTCTGACCTCAGAAGATCCAGTGACCATGATGGATTCCATTTTGAATGATAACATCAATCTTTTGGGAAAGGTTGAGCTGTTGGATTATCTTGACAGTATTGACTGCAGTTTAGAGGACTTCCAGGCCATGCTATCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yunling Wen et al.
Scandinavian journal of gastroenterology, 55(6), 677-686 (2020-06-17)
Background: Mucosal healing(MH) is a treatment goal in ulcerative colitis (UC). Our previous studies showed heat shock transcription factor 2 (HSF2) was positively correlated with the activity of UC and had anti-inflammatory potential in DSS-induced colitis, but the role of
Jenny Joutsen et al.
Cell reports, 30(2), 583-597 (2020-01-16)
Maintenance of protein homeostasis, through inducible expression of molecular chaperones, is essential for cell survival under protein-damaging conditions. The expression and DNA-binding activity of heat shock factor 2 (HSF2), a member of the heat shock transcription factor family, increase upon

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service