Skip to Content
Merck
All Photos(1)

Key Documents

EHU133271

Sigma-Aldrich

MISSION® esiRNA

targeting human NCOA4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
1.360,00 kr.
50 μG
2.440,00 kr.

1.360,00 kr.


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
1.360,00 kr.
50 μG
2.440,00 kr.

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

1.360,00 kr.


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCAGCCTTTCTGCTGATTATCACACATCATGAGCTGAGTGACTGCAGCTTGCCAAATCTTTGTGTTTCTGGGTCTGACCAATTAGCTTAGTTCTTCTCCTGCCTAATTTTGAACTAGTAAAGCAAAGTGAGTCATCAGATTATGAGTTACTGTTTAAAAGAAAAATGCTGTTTATTCATGCTGAGGTGATTCAGTTCCCTCCTTCTTACAGAAGTATTTTAATTCACCCCACACTAGAAATGCAGCATCTTTGTGGACGTCTTTTTCACAAGCCTCCAAGGCTCCTTAGATTGGGTCGTTACTAAAAGTACATTAAAACACTCTTGTTTATCGAAGTATATTGATGTATTCTAAAGCTAGTAAACTTCCCTAACGTTTAATTGCCCTACAGATGCTTCTCTTGCTGTGGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Motoki Fujimaki et al.
Molecular and cellular biology, 39(14) (2019-05-08)
Iron is an essential nutrient for mitochondrial metabolic processes, including mitochondrial respiration. Ferritin complexes store excess iron and protect cells from iron toxicity. Therefore, iron stored in the ferritin complex might be utilized under iron-depleted conditions. In this study, we
Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service