Skip to Content
Merck
All Photos(1)

Key Documents

EHU087521

Sigma-Aldrich

MISSION® esiRNA

targeting human SPRY1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
1.360,00 kr.
50 μG
2.440,00 kr.

1.360,00 kr.


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
1.360,00 kr.
50 μG
2.440,00 kr.

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

1.360,00 kr.


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGTCACCACCAACCAGACCAGTCCCTGGTCATAGGTCTGAAAGGGCAATCCGGACCCAGCCCAAGCAACTGATTGTGGATGACTTGAAGGGTTCCTTGAAAGAGGACCTGACACAGCACAAGTTCATTTGTGAACAGTGTGGGAAGTGCAAGTGTGGAGAATGCACTGCTCCCAGGACCCTACCATCCTGTTTGGCCTGTAACCGGCAGTGCCTTTGCTCTGCTGAGAGCATGGTGGAATATGGAACCTGCATGTGCTTAGTCAAGGGCATCTTCTACCACTGCTCCAATGACGACGAAGGGGATTCCTATTCAGATAATCCTTGCTCCTGTTCACAATCACACTGCTGCTCTAGATACCTGTGTATGGGAGCCATGTCTTTATTTTTACCTTGCTTACTCTGTTATCCTCCTGCTAAAGGATGCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Z-S Yuan et al.
European review for medical and pharmacological sciences, 21(22), 5072-5080 (2017-12-12)
Gliomas are accompanied with high mortality owning to their invasive peculiarity and vulnerability to drug resistance. miR-21 is a vital oncogenic miRNA that regulates drug resistance of tumor cells. This study aims to elucidate the function of miR-21 in human
Juliana F Germano et al.
Virology, 529, 169-176 (2019-02-04)
Coxsackievirus B is a significant human pathogen and is a leading cause of myocarditis. We and others have observed that certain enteroviruses including coxsackievirus B cause infected cells to shed extracellular vesicles containing infectious virus. Recent reports have shown that
Naoki Terada et al.
Journal of cellular biochemistry, 115(9), 1505-1515 (2014-03-08)
Prostate cancer is a heterogeneous disease and thus, it is important to understand whether among the heterogeneous collection of cell types, androgen-deprivation insensitive cells exist prior to hormonal manipulation. We established several LNCaP subclones with distinct insensitivities to androgen deprivation

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service