Transfection protocols vary from transfection reagent and cell line. Transfect the cell line of interest with esiRNA following the manufacturer’s instructions for the transfection reagent. esiRNA should be tested in a pilot experiment to validate the best concentration and experimental procedure to use with every cell line. Known transfection conditions used for chemically synthesized siRNA are a good starting point for optimization.
Select a Size
20 μG
1.360,00 kr.
50 μG
2.440,00 kr.
1.360,00 kr.
Please contact Customer Service for Availability
All Photos(1)
Select a Size
Change View
20 μG
1.360,00 kr.
50 μG
2.440,00 kr.
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
1.360,00 kr.
Please contact Customer Service for Availability
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Related Categories
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Lot/Batch Number
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hyun Min Lee et al.
Scientific reports, 7(1), 13201-13201 (2017-10-19)
Circulating tumor cells (CTCs) play a major role in the metastasis and recurrence of hepatocellular carcinoma (HCC). Here, we found that major vault protein (MVP) is expressed on the surface of HCC cells and further induced under stressful environments. MVP
Shi Liu et al.
Journal of hepatology, 62(5), 1015-1023 (2014-12-08)
We previously demonstrated that major vault protein (MVP) is a novel virus-induced host factor and its expression upregulates type-I interferon production, leading to cellular antiviral response. However, it remains unclear whether the antiviral function of MVP is impaired during hepatitis
-
How long should I transfect cells with this product?
1 answer-
Helpful?
-
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
