Skip to Content
Merck
All Photos(1)

Key Documents

EHU084381

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM5B

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
1.360,00 kr.
50 μG
2.440,00 kr.

1.360,00 kr.


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
1.360,00 kr.
50 μG
2.440,00 kr.

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

1.360,00 kr.


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGCATTATCGCTTGCTTCATCGATATTGTGTGTTTTCCCACGATGAGATGATCTGCAAGATGGCTTCCAAGGCTGATGTATTAGATGTTGTAGTGGCTTCAACTGTTCAGAAAGACATGGCCATTATGATTGAGGATGAGAAAGCTTTAAGAGAAACTGTCCGTAAATTGGGAGTGATTGATTCGGAAAGAATGGATTTTGAGCTGTTGCCAGATGATGAACGTCAGTGTGTAAAATGCAAAACTACATGCTTCATGTCTGCCATCTCCTGTTCTTGTAAACCTGGCCTTCTTGTTTGCCTGCATCATGTAAAAGAATTGTGTTCCTGTCCTCCTTACAAATATAAATTGCGGTATAGGTACACGCTGGATGATCTCTACCCTATGATGAATGCATTGAAGCTTCGAGCAGAATCTTACAACGAATGGGCCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kuang-Tai Kuo et al.
Clinical epigenetics, 10(1), 107-107 (2018-08-11)
Lung cancer is the leading cause of cancer death worldwide. Recently, epigenetic dysregulation has been known to promote tumor progression and therefore may be a therapeutic target for anticancer therapy. JARID1B, a member of histone demethylases, has been found to
Chun-Shu Lin et al.
Cancer letters, 368(1), 36-45 (2015-07-18)
Oral squamous cell carcinoma (OSCC) is a major cause of human mortality globally and radiotherapy is one of the main treatment modalities, however its therapeutic effect is often limited by radioresistance. JARID1B is an epigenetic factor with reported oncogenic potential

Questions

  1. Hi - could you please let me know if esiRNA against KDM5B (human) also targets the mouse transcript? Thank you!

    1 answer
    1. Product EHU084381 has not been tested internally in mouse but the esiRNA cDNA target sequence for EHU084381 has 100% homology against Mus musculus lysine demethylase 5B (Kdm5b), mRNA, NM_152895.2.

      Helpful?

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service