Skip to Content
Merck
All Photos(1)

Documents

EHU064361

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCCTCATGATCACAGCCTCTACATATGCAATAAGAGTTTCTAACTATGATATCTTCTGGTATACTCATAACCTCTTCTTTGTCTTCTACATGCTGCTGACGTTGCATGTTTCAGGAGGGCTGCTGAAGTATCAAACTAATTTAGATACCCACCCTCCCGGCTGCATCAGTCTTAACCGAACCAGCTCTCAGAATATTTCCTTACCAGAGTATTTCTCAGAACATTTTCATGAACCTTTCCCTGAAGGATTTTCAAAACCGGCAGAGTTTACCCAGCACAAATTTGTGAAGATTTGTATGGAAGAGCCCAGATTCCAAGCTAATTTTCCACAGACTTGGCTTTGGATTTCTGGACCTTTGTGCCTGTACTGTGCCGAAAGACTTTACAGGTATATCCGGAGCAATAAGCCAGTCACCATCATTTCGGTCATGAGTCATCCCTCAGATGTCATGGAAATCCGAATGGTCAA

Ensembl | human accession no.

ENSG00000086991

NCBI accession no.

NM_016931

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NOX4(50507) , NOX4(50507)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenwen Zhao et al.
Scientific reports, 7(1), 12953-12953 (2017-10-13)
ICAM-1 overexpression and subsequent adhesion of leukocytes to endothelial cells play critical roles in the early stage of atherosclerosis. Danshenol A (DA) is an abietane-type diterpenoid isolated from traditional Chinese herb Salvia miltiorrhiza Bunge. The mechanisms under its regulation of
Weichao Guo et al.
American journal of physiology. Lung cellular and molecular physiology, 312(6), L936-L944 (2017-03-25)
Myofibroblasts are important mediators of fibrogenesis; thus blocking fibroblast-to-myofibroblast differentiation (FMD) may be an effective strategy to treat pulmonary fibrosis (PF). Previously, we reported that histone deacetylase 4 (HDAC4) activity is necessary for transforming growth factor-β
Yongpan Huang et al.
Oxidative medicine and cellular longevity, 2020, 3912173-3912173 (2020-12-05)
Oxymatrine (OMT) is the major quinolizidine alkaloid extracted from the root of Sophora flavescens Ait and has been shown to exhibit a diverse range of pharmacological properties. The aim of the present study was to investigate the role of OMT
Qipeng Wu et al.
Experimental cell research, 352(2), 245-254 (2017-02-16)
The redox adaptation mechanisms in cancer cells are very complex and remain largely unclear. Our previous studies have confirmed that NADPH oxidase 4 (NOX4) is abundantly expressed in non-small cell lung cancer (NSCLC) and confers apoptosis resistance on NSCLC cells.
Qian Sun et al.
Biochimica et biophysica acta, 1861(1 Pt A), 2912-2921 (2016-10-23)
Oxidative stress plays a crucial role in the development of alcoholic liver disease (ALD), however effective pharmacological treatment for oxidative injury is still lacking. The objective of this study was to determine whether inhibition of NADPH oxidase activity could reverse
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service