Skip to Content
Merck
All Photos(1)

Documents

EHU058181

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF43

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGAAAGGAAGGGCCAAAACTACGACTTGGCTTTCTGAAACGGAAGCATAAATGTTCTTTTCCTCCATTTGTCTGGATCTGAGAACCTGCATTTGGTATTAGCTAGTGGAAGCAGTATGTATGGTTGAAGTGCATTGCTGCAGCTGGTAGCATGAGTGGTGGCCACCAGCTGCAGCTGGCTGCCCTCTGGCCCTGGCTGCTGATGGCTACCCTGCAGGCAGGCTTTGGACGCACAGGACTGGTACTGGCAGCAGCGGTGGAGTCTGAAAGATCAGCAGAACAGAAAGCTATTATCAGAGTGATCCCCTTGAAAATGGACCCCACAGGAAAACTGAATCTCACTTTGGAAGGTGTGTTTGCTGGTGTTGCTGAAATAACTCCAGCAGAAGGAAAATTAATGCAGTCCCACCCGCTGTACCTGTGCAATGCCAGTGATGACGACAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yun Sol Jo et al.
Human pathology, 46(11), 1640-1646 (2015-08-25)
RNF43, an E3 ligase, inhibits Wnt signaling by removing Wnt receptors and behaves as a candidate tumor suppressor. Recent studies identified that RNF43 gene was frequently mutated in gastric (GC), colorectal (CRC), and endometrial cancers with high microsatellite instability (MSI-H).
Tadasuke Tsukiyama et al.
Molecular and cellular biology, 35(11), 2007-2023 (2015-04-01)
Wnt signaling pathways are tightly regulated by ubiquitination, and dysregulation of these pathways promotes tumorigenesis. It has been reported that the ubiquitin ligase RNF43 plays an important role in frizzled-dependent regulation of the Wnt/β-catenin pathway. Here, we show that RNF43
H Nailwal et al.
Cell death & disease, 6, e1768-e1768 (2015-05-23)
The interplay between influenza virus and host factors to support the viral life cycle is well documented. Influenza A virus (IAV) proteins interact with an array of cellular proteins and hijack host pathways which are at the helm of cellular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service